Incidental Mutation 'R7048:Ncf2'
ID547406
Institutional Source Beutler Lab
Gene Symbol Ncf2
Ensembl Gene ENSMUSG00000026480
Gene Nameneutrophil cytosolic factor 2
SynonymsNOXA2, p67phox, Ncf-2, NADPH oxidase subunit (67kDa)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location152800194-152836991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 152808170 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 47 (N47H)
Ref Sequence ENSEMBL: ENSMUSP00000140404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027754] [ENSMUST00000186568] [ENSMUST00000190323]
Predicted Effect probably benign
Transcript: ENSMUST00000027754
AA Change: N47H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027754
Gene: ENSMUSG00000026480
AA Change: N47H

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186568
AA Change: N47H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140404
Gene: ENSMUSG00000026480
AA Change: N47H

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190323
SMART Domains Protein: ENSMUSP00000139774
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
Pfam:TPR_1 1 26 5.8e-4 PFAM
low complexity region 54 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Ncf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Ncf2 APN 1 152808174 missense possibly damaging 0.49
IGL00952:Ncf2 APN 1 152836106 missense probably benign 0.19
IGL01504:Ncf2 APN 1 152833329 missense probably benign 0.00
IGL01693:Ncf2 APN 1 152824323 missense probably benign 0.00
IGL02005:Ncf2 APN 1 152817052 missense possibly damaging 0.73
IGL02041:Ncf2 APN 1 152836120 utr 3 prime probably benign
IGL02327:Ncf2 APN 1 152816993 missense possibly damaging 0.49
IGL02366:Ncf2 APN 1 152835073 missense probably benign
IGL02627:Ncf2 APN 1 152811008 splice site probably benign
R0560:Ncf2 UTSW 1 152821522 missense probably damaging 1.00
R1136:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R1640:Ncf2 UTSW 1 152808033 start codon destroyed probably null 1.00
R1673:Ncf2 UTSW 1 152830479 missense probably benign 0.13
R1836:Ncf2 UTSW 1 152808071 missense probably damaging 1.00
R1873:Ncf2 UTSW 1 152825910 missense probably benign 0.00
R1940:Ncf2 UTSW 1 152834064 splice site probably benign
R1967:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R3405:Ncf2 UTSW 1 152825947 unclassified probably benign
R3406:Ncf2 UTSW 1 152825947 unclassified probably benign
R4501:Ncf2 UTSW 1 152835033 missense probably benign 0.00
R4503:Ncf2 UTSW 1 152833778 missense probably benign 0.20
R4563:Ncf2 UTSW 1 152808225 intron probably benign
R5841:Ncf2 UTSW 1 152821518 splice site silent
R6336:Ncf2 UTSW 1 152834070 missense probably damaging 1.00
R6385:Ncf2 UTSW 1 152830422 missense probably benign 0.00
R6522:Ncf2 UTSW 1 152827463 critical splice donor site probably null
R6811:Ncf2 UTSW 1 152836040 missense probably benign 0.00
X0066:Ncf2 UTSW 1 152810979 start codon destroyed probably null 0.27
Predicted Primers PCR Primer
(F):5'- CATCCTGCCTTCTGGTAAGC -3'
(R):5'- GATCTCATAAAGAGCAGAGCCC -3'

Sequencing Primer
(F):5'- TTCTGGTAAGCACCTAACCATG -3'
(R):5'- GCCCTGGGAGCTTTTAAAAC -3'
Posted On2019-05-13