Incidental Mutation 'R7048:Itga8'
ID 547408
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 045146-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R7048 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12115895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 77 (V77A)
Ref Sequence ENSEMBL: ENSMUSP00000134238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000148055] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect possibly damaging
Transcript: ENSMUST00000028106
AA Change: V998A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: V998A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148055
AA Change: V77A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134238
Gene: ENSMUSG00000026768
AA Change: V77A

DomainStartEndE-ValueType
SCOP:d1m1xa3 1 79 7e-32 SMART
PDB:3IJE|A 2 89 9e-15 PDB
transmembrane domain 90 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,552,565 (GRCm39) D629G probably damaging Het
Akap11 T A 14: 78,749,954 (GRCm39) Q811L Het
Ank2 T A 3: 126,819,267 (GRCm39) Q468L probably benign Het
Ano3 A T 2: 110,513,116 (GRCm39) Y626* probably null Het
Ap1m1 A G 8: 73,003,642 (GRCm39) N114S probably damaging Het
Asb3 T A 11: 31,051,121 (GRCm39) I525N probably damaging Het
Atg4a-ps A G 3: 103,552,672 (GRCm39) I223T probably damaging Het
B3gnt7 T C 1: 86,233,308 (GRCm39) Y68H probably benign Het
Bbs5 T C 2: 69,484,705 (GRCm39) I125T probably benign Het
Cd180 A G 13: 102,841,431 (GRCm39) N159S probably damaging Het
Cd37 T C 7: 44,887,888 (GRCm39) probably benign Het
Cdk14 T A 5: 5,143,005 (GRCm39) Q242L probably damaging Het
Clcn1 T C 6: 42,284,477 (GRCm39) V605A probably damaging Het
Cped1 G A 6: 22,119,469 (GRCm39) M309I probably benign Het
Cyp2r1 A T 7: 114,151,971 (GRCm39) Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 (GRCm39) S124R probably benign Het
Dlec1 A T 9: 118,972,472 (GRCm39) probably null Het
Dnah17 T C 11: 117,936,944 (GRCm39) E3420G possibly damaging Het
Dnajc13 C T 9: 104,080,613 (GRCm39) probably null Het
Dusp23 A T 1: 172,459,253 (GRCm39) Y136* probably null Het
Eif4b A G 15: 102,001,571 (GRCm39) probably benign Het
F13a1 A G 13: 37,082,117 (GRCm39) V529A probably benign Het
Fhl2 A G 1: 43,162,808 (GRCm39) Y236H probably damaging Het
Gm826 C T 2: 160,169,026 (GRCm39) W94* probably null Het
Gpsm2 C T 3: 108,610,361 (GRCm39) R33H probably damaging Het
Hmcn1 T C 1: 150,475,404 (GRCm39) probably null Het
Ifit1bl2 T C 19: 34,596,551 (GRCm39) D355G probably benign Het
Kcmf1 C T 6: 72,826,450 (GRCm39) R40K probably damaging Het
Kdm7a T C 6: 39,145,982 (GRCm39) E315G probably damaging Het
Kmt2b C T 7: 30,268,731 (GRCm39) G2666D probably damaging Het
Lrrtm1 A G 6: 77,221,152 (GRCm39) N203S probably damaging Het
Mdn1 A G 4: 32,767,969 (GRCm39) N5301D probably benign Het
Mest T G 6: 30,742,723 (GRCm39) H108Q probably damaging Het
Mettl25b A G 3: 87,837,167 (GRCm39) I36T probably damaging Het
Moxd1 C A 10: 24,157,374 (GRCm39) D335E probably damaging Het
Ncf2 A C 1: 152,683,921 (GRCm39) N47H probably benign Het
Npc1 A G 18: 12,337,822 (GRCm39) probably null Het
Or14j2 A T 17: 37,886,114 (GRCm39) S67T probably damaging Het
Pcid2 A G 8: 13,128,243 (GRCm39) V386A probably benign Het
Phactr2 T A 10: 13,121,168 (GRCm39) T444S probably benign Het
Plekha7 T C 7: 115,747,559 (GRCm39) N710D probably benign Het
Ppp1r16b C T 2: 158,599,174 (GRCm39) T382I probably benign Het
Pramel15 T C 4: 144,103,754 (GRCm39) D124G probably benign Het
Ptprz1 A T 6: 22,961,622 (GRCm39) Y111F probably benign Het
Rbbp8 A G 18: 11,865,277 (GRCm39) E722G possibly damaging Het
Rimbp3 A G 16: 17,028,190 (GRCm39) D538G probably benign Het
Rims1 A G 1: 22,511,901 (GRCm39) S551P probably damaging Het
Rsrc1 A G 3: 67,088,164 (GRCm39) D166G probably damaging Het
Selenon T C 4: 134,270,154 (GRCm39) N350S probably benign Het
Sh3gl2 T A 4: 85,295,802 (GRCm39) L168H probably damaging Het
Smc3 T C 19: 53,617,682 (GRCm39) Y560H probably benign Het
Syce1 C T 7: 140,359,281 (GRCm39) D147N possibly damaging Het
Syt10 A C 15: 89,675,008 (GRCm39) V446G probably damaging Het
Taar1 T C 10: 23,796,722 (GRCm39) L140P probably benign Het
Tfpi2 C A 6: 3,968,032 (GRCm39) C36F probably damaging Het
Thoc5 G A 11: 4,876,237 (GRCm39) probably null Het
Tnrc6c T A 11: 117,612,800 (GRCm39) N319K probably benign Het
Trhr2 C T 8: 123,085,418 (GRCm39) D189N probably damaging Het
Trim42 A T 9: 97,245,474 (GRCm39) F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 (GRCm39) T949I possibly damaging Het
Ugt1a8 T C 1: 88,016,024 (GRCm39) F146L probably benign Het
Vmn2r80 C A 10: 79,030,153 (GRCm39) Q660K probably damaging Het
Vstm2b C T 7: 40,578,800 (GRCm39) T258I possibly damaging Het
Washc2 T C 6: 116,197,544 (GRCm39) L259P possibly damaging Het
Zscan18 A T 7: 12,508,671 (GRCm39) probably benign Het
Zzef1 T G 11: 72,757,525 (GRCm39) Y1193* probably null Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACACAATACTCTCCTATCCTTGAG -3'
(R):5'- GGTCAAGTTCAATTGCTATGACC -3'

Sequencing Primer
(F):5'- CCTTGAGGATTTATCAAAGATCAGC -3'
(R):5'- AAGTTCAATTGCTATGACCTTCTC -3'
Posted On 2019-05-13