Incidental Mutation 'R7048:Bbs5'
ID547409
Institutional Source Beutler Lab
Gene Symbol Bbs5
Ensembl Gene ENSMUSG00000063145
Gene NameBardet-Biedl syndrome 5 (human)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location69647171-69667571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69654361 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 125 (I125T)
Ref Sequence ENSEMBL: ENSMUSP00000107905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074963] [ENSMUST00000112286] [ENSMUST00000134659]
Predicted Effect probably benign
Transcript: ENSMUST00000074963
AA Change: I125T

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074494
Gene: ENSMUSG00000063145
AA Change: I125T

DomainStartEndE-ValueType
Pfam:DUF1448 7 339 6.2e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112286
AA Change: I125T

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107905
Gene: ENSMUSG00000063145
AA Change: I125T

DomainStartEndE-ValueType
Pfam:DUF1448 6 208 1.6e-100 PFAM
Pfam:DUF1448 206 319 9.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127806
SMART Domains Protein: ENSMUSP00000121691
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 22 90 9.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134659
SMART Domains Protein: ENSMUSP00000119377
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 88 3.1e-36 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is required for the formation of cilia. Alternate transcriptional splice variants have been observed but have not been fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Bbs5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01693:Bbs5 APN 2 69663080 missense probably benign
IGL01695:Bbs5 APN 2 69649090 missense probably damaging 1.00
IGL02232:Bbs5 APN 2 69655551 missense probably benign 0.37
IGL02418:Bbs5 APN 2 69655505 makesense probably null
IGL03280:Bbs5 APN 2 69666971 splice site probably benign
R4801:Bbs5 UTSW 2 69655614 missense probably damaging 1.00
R4802:Bbs5 UTSW 2 69655614 missense probably damaging 1.00
R4974:Bbs5 UTSW 2 69647234 start gained probably benign
R6560:Bbs5 UTSW 2 69656956 missense probably damaging 1.00
R6936:Bbs5 UTSW 2 69654354 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACCTTAAATGGGAACTTGCTC -3'
(R):5'- CTTGCTAGAGTGCTGGAGAAG -3'

Sequencing Primer
(F):5'- GGGAACTTGCTCTTTAACTCTGAAAC -3'
(R):5'- CCCTTGTACACAGATGTTCAGAG -3'
Posted On2019-05-13