Mutagenetix > Incidental Mutation

Incidental Mutation 'R7048:Ano3'

547410

Institutional Source

Beutler Lab

Gene Symbol

Ano3

Ensembl Gene

ENSMUSG00000074968

Gene Name

anoctamin 3

Synonyms

Tmem16c, B230324K02Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R7048 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110655201-110950923 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 110682771 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 626 (Y626*)

Ref Sequence

ENSEMBL: ENSMUSP00000097219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099623]

AlphaFold

A2AHL1

Predicted Effect

probably null
Transcript: ENSMUST00000099623
AA Change: Y626*

SMART Domains

Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: Y626*

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	156	381	2.9e-70	PFAM
Pfam:Anoctamin	384	950	4.4e-138	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,846,929	D629G	probably damaging	Het
Akap11	T	A	14: 78,512,514	Q811L		Het
Ank2	T	A	3: 127,025,618	Q468L	probably benign	Het
Ap1m1	A	G	8: 72,249,798	N114S	probably damaging	Het
Asb3	T	A	11: 31,101,121	I525N	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,356	I223T	probably damaging	Het
B3gnt7	T	C	1: 86,305,586	Y68H	probably benign	Het
Bbs5	T	C	2: 69,654,361	I125T	probably benign	Het
Cd180	A	G	13: 102,704,923	N159S	probably damaging	Het
Cd37	T	C	7: 45,238,464		probably benign	Het
Cdk14	T	A	5: 5,093,005	Q242L	probably damaging	Het
Clcn1	T	C	6: 42,307,543	V605A	probably damaging	Het
Cped1	G	A	6: 22,119,470	M309I	probably benign	Het
Cyp2r1	A	T	7: 114,552,736	Y120N	probably damaging	Het
Ddx3y	A	T	Y: 1,279,491	S124R	probably benign	Het
Dlec1	A	T	9: 119,143,404		probably null	Het
Dnah17	T	C	11: 118,046,118	E3420G	possibly damaging	Het
Dnajc13	C	T	9: 104,203,414		probably null	Het
Dusp23	A	T	1: 172,631,686	Y136*	probably null	Het
Eif4b	A	G	15: 102,093,136		probably benign	Het
F13a1	A	G	13: 36,898,143	V529A	probably benign	Het
Fhl2	A	G	1: 43,123,648	Y236H	probably damaging	Het
Gm826	C	T	2: 160,327,106	W94*	probably null	Het
Gpsm2	C	T	3: 108,703,045	R33H	probably damaging	Het
Hmcn1	T	C	1: 150,599,653		probably null	Het
Ifit1bl2	T	C	19: 34,619,151	D355G	probably benign	Het
Itga8	A	G	2: 12,111,084	V77A	probably damaging	Het
Kcmf1	C	T	6: 72,849,467	R40K	probably damaging	Het
Kdm7a	T	C	6: 39,169,048	E315G	probably damaging	Het
Kmt2b	C	T	7: 30,569,306	G2666D	probably damaging	Het
Lrrtm1	A	G	6: 77,244,169	N203S	probably damaging	Het
Mdn1	A	G	4: 32,767,969	N5301D	probably benign	Het
Mest	T	G	6: 30,742,724	H108Q	probably damaging	Het
Moxd1	C	A	10: 24,281,476	D335E	probably damaging	Het
Ncf2	A	C	1: 152,808,170	N47H	probably benign	Het
Npc1	A	G	18: 12,204,765		probably null	Het
Olfr113	A	T	17: 37,575,223	S67T	probably damaging	Het
Pcid2	A	G	8: 13,078,243	V386A	probably benign	Het
Phactr2	T	A	10: 13,245,424	T444S	probably benign	Het
Plekha7	T	C	7: 116,148,324	N710D	probably benign	Het
Ppp1r16b	C	T	2: 158,757,254	T382I	probably benign	Het
Pramef20	T	C	4: 144,377,184	D124G	probably benign	Het
Ptprz1	A	T	6: 22,961,623	Y111F	probably benign	Het
Rbbp8	A	G	18: 11,732,220	E722G	possibly damaging	Het
Rimbp3	A	G	16: 17,210,326	D538G	probably benign	Het
Rims1	A	G	1: 22,472,820	S551P	probably damaging	Het
Rrnad1	A	G	3: 87,929,860	I36T	probably damaging	Het
Rsrc1	A	G	3: 67,180,831	D166G	probably damaging	Het
Selenon	T	C	4: 134,542,843	N350S	probably benign	Het
Sh3gl2	T	A	4: 85,377,565	L168H	probably damaging	Het
Smc3	T	C	19: 53,629,251	Y560H	probably benign	Het
Syce1	C	T	7: 140,779,368	D147N	possibly damaging	Het
Syt10	A	C	15: 89,790,805	V446G	probably damaging	Het
Taar1	T	C	10: 23,920,824	L140P	probably benign	Het
Tfpi2	C	A	6: 3,968,032	C36F	probably damaging	Het
Thoc5	G	A	11: 4,926,237		probably null	Het
Tnrc6c	T	A	11: 117,721,974	N319K	probably benign	Het
Trhr2	C	T	8: 122,358,679	D189N	probably damaging	Het
Trim42	A	T	9: 97,363,421	F442Y	probably damaging	Het
Ubap2	G	A	4: 41,196,033	T949I	possibly damaging	Het
Ugt1a8	T	C	1: 88,088,302	F146L	probably benign	Het
Vmn2r80	C	A	10: 79,194,319	Q660K	probably damaging	Het
Vstm2b	C	T	7: 40,929,376	T258I	possibly damaging	Het
Washc2	T	C	6: 116,220,583	L259P	possibly damaging	Het
Zscan18	A	T	7: 12,774,744		probably benign	Het
Zzef1	T	G	11: 72,866,699	Y1193*	probably null	Het

Other mutations in Ano3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Ano3	APN	2	110771050	splice site	probably benign
IGL01066:Ano3	APN	2	110661445	missense	probably null	0.00
IGL01696:Ano3	APN	2	110667737	missense	probably damaging	1.00
IGL01729:Ano3	APN	2	110781394	splice site	probably null
IGL01785:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01786:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01992:Ano3	APN	2	110658219	missense	probably damaging	1.00
IGL02098:Ano3	APN	2	110666441	nonsense	probably null
IGL02333:Ano3	APN	2	110697199	splice site	probably benign
IGL02346:Ano3	APN	2	110770926	splice site	probably benign
IGL02352:Ano3	APN	2	110884943	nonsense	probably null
IGL02359:Ano3	APN	2	110884943	nonsense	probably null
IGL02544:Ano3	APN	2	110658249	missense	possibly damaging	0.79
IGL02750:Ano3	APN	2	110665984	splice site	probably benign
IGL02861:Ano3	APN	2	110738812	missense	probably damaging	1.00
IGL02948:Ano3	APN	2	110697018	splice site	probably benign
IGL03327:Ano3	APN	2	110697178	missense	possibly damaging	0.62
3-1:Ano3	UTSW	2	110697124	missense	probably damaging	1.00
IGL02988:Ano3	UTSW	2	110775010	missense	probably damaging	1.00
IGL03147:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
R0349:Ano3	UTSW	2	110661487	missense	probably damaging	1.00
R0426:Ano3	UTSW	2	110661174	missense	probably damaging	1.00
R0523:Ano3	UTSW	2	110884855	missense	probably benign	0.13
R0557:Ano3	UTSW	2	110862952	splice site	probably null
R0611:Ano3	UTSW	2	110885001	missense	possibly damaging	0.93
R0891:Ano3	UTSW	2	110697976	missense	probably benign	0.03
R1459:Ano3	UTSW	2	110880829	missense	probably benign	0.00
R1460:Ano3	UTSW	2	110682758	missense	probably damaging	0.97
R1773:Ano3	UTSW	2	110761455	missense	probably damaging	1.00
R1874:Ano3	UTSW	2	110884872	missense	probably benign	0.00
R1919:Ano3	UTSW	2	110885007	missense	probably benign
R2185:Ano3	UTSW	2	110775045	missense	probably benign	0.01
R2280:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2281:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2348:Ano3	UTSW	2	110783743	missense	possibly damaging	0.82
R2425:Ano3	UTSW	2	110862843	missense	probably benign
R2697:Ano3	UTSW	2	110794960	missense	possibly damaging	0.79
R3888:Ano3	UTSW	2	110885000	missense	probably damaging	0.99
R3923:Ano3	UTSW	2	110770959	missense	probably damaging	1.00
R4352:Ano3	UTSW	2	110745894	missense	possibly damaging	0.74
R4447:Ano3	UTSW	2	110761578	splice site	probably null
R4790:Ano3	UTSW	2	110884919	missense	probably benign
R4832:Ano3	UTSW	2	110667722	missense	probably damaging	1.00
R4916:Ano3	UTSW	2	110771020	missense	possibly damaging	0.74
R5113:Ano3	UTSW	2	110661480	missense	possibly damaging	0.61
R5486:Ano3	UTSW	2	110745870	missense	probably damaging	1.00
R5498:Ano3	UTSW	2	110697103	missense	possibly damaging	0.68
R5589:Ano3	UTSW	2	110884995	missense	probably damaging	0.99
R5627:Ano3	UTSW	2	110756953	missense	possibly damaging	0.61
R5741:Ano3	UTSW	2	110658273	missense	probably benign	0.11
R5767:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R5883:Ano3	UTSW	2	110880864	missense	probably null	0.15
R5899:Ano3	UTSW	2	110862887	missense	probably benign	0.39
R5916:Ano3	UTSW	2	110681836	missense	probably benign	0.29
R6158:Ano3	UTSW	2	110665875	missense	probably damaging	1.00
R6315:Ano3	UTSW	2	110697039	missense	probably damaging	1.00
R6401:Ano3	UTSW	2	110775114	missense	probably benign	0.01
R6481:Ano3	UTSW	2	110795027	missense	probably benign	0.16
R6482:Ano3	UTSW	2	110697055	missense	probably damaging	1.00
R6587:Ano3	UTSW	2	110797904	splice site	probably null
R6811:Ano3	UTSW	2	110880867	missense	probably benign	0.03
R7145:Ano3	UTSW	2	110862860	missense	probably benign	0.31
R7207:Ano3	UTSW	2	110781423	missense	probably damaging	0.96
R7215:Ano3	UTSW	2	110665932	missense	probably damaging	1.00
R7366:Ano3	UTSW	2	110757067	missense	probably damaging	1.00
R7371:Ano3	UTSW	2	110884849	critical splice donor site	probably null
R7568:Ano3	UTSW	2	110950293	start gained	probably benign
R7636:Ano3	UTSW	2	110682703	nonsense	probably null
R7888:Ano3	UTSW	2	110666428	missense	probably damaging	1.00
R7992:Ano3	UTSW	2	110775022	missense	possibly damaging	0.77
R8024:Ano3	UTSW	2	110667783	missense	probably damaging	0.99
R8074:Ano3	UTSW	2	110950232	start gained	probably benign
R8111:Ano3	UTSW	2	110783713	missense	possibly damaging	0.95
R8177:Ano3	UTSW	2	110666456	missense	probably damaging	1.00
R8297:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R8485:Ano3	UTSW	2	110667855	critical splice acceptor site	probably null
R8509:Ano3	UTSW	2	110665835	missense	possibly damaging	0.50
R8870:Ano3	UTSW	2	110783729	missense	probably benign	0.12
R9071:Ano3	UTSW	2	110795073	critical splice acceptor site	probably null
R9072:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9073:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9315:Ano3	UTSW	2	110697942	missense	probably damaging	0.97
R9376:Ano3	UTSW	2	110666437	missense	probably damaging	1.00
R9588:Ano3	UTSW	2	110697997	missense	possibly damaging	0.91
RF012:Ano3	UTSW	2	110697523	missense	possibly damaging	0.83
RF013:Ano3	UTSW	2	110697036	missense	probably benign	0.30
X0058:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
Z1088:Ano3	UTSW	2	110745847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTGGCAATGGGGATGCTG -3'
(R):5'- CCACACTAGAATCTTCCCATAGTG -3'

Sequencing Primer
(F):5'- CAATGGGGATGCTGTTTGTG -3'
(R):5'- TCCCATAGTGTTTTTCATATGCAAC -3'

Posted On

2019-05-13