Incidental Mutation 'R7048:Ppp1r16b'
ID547411
Institutional Source Beutler Lab
Gene Symbol Ppp1r16b
Ensembl Gene ENSMUSG00000037754
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 16B
SynonymsC130078N17Rik, Wdt4, ANKRD4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location158665398-158766334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 158757254 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 382 (T382I)
Ref Sequence ENSEMBL: ENSMUSP00000099405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045503] [ENSMUST00000052927] [ENSMUST00000103116] [ENSMUST00000145073]
Predicted Effect probably benign
Transcript: ENSMUST00000045503
AA Change: T382I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039540
Gene: ENSMUSG00000037754
AA Change: T382I

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052927
AA Change: T382I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062615
Gene: ENSMUSG00000037754
AA Change: T382I

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103116
AA Change: T382I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099405
Gene: ENSMUSG00000037754
AA Change: T382I

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129902
Predicted Effect probably benign
Transcript: ENSMUST00000145073
AA Change: T282I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117310
Gene: ENSMUSG00000037754
AA Change: T282I

DomainStartEndE-ValueType
ANK 9 38 5.69e2 SMART
ANK 42 71 5.04e-6 SMART
ANK 75 104 1.76e-5 SMART
Blast:ANK 149 190 5e-18 BLAST
low complexity region 201 214 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is membrane-associated and contains five ankyrin repeats, a protein phosphatase-1-interacting domain, and a carboxy-terminal CAAX box domain. Synthesis of the encoded protein is inhibited by transforming growth factor beta-1. The protein may bind to the membrane through its CAAX box domain and may act as a signaling molecule through interaction with protein phosphatase-1. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable defects in thymopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Ppp1r16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ppp1r16b APN 2 158756965 missense probably damaging 1.00
IGL01024:Ppp1r16b APN 2 158740816 splice site probably benign
IGL01080:Ppp1r16b APN 2 158757172 missense probably damaging 0.99
IGL02106:Ppp1r16b APN 2 158746531 missense possibly damaging 0.51
IGL03084:Ppp1r16b APN 2 158761493 nonsense probably null
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0190:Ppp1r16b UTSW 2 158696063 missense probably damaging 1.00
R0294:Ppp1r16b UTSW 2 158746603 missense probably damaging 1.00
R1735:Ppp1r16b UTSW 2 158761495 missense possibly damaging 0.94
R1746:Ppp1r16b UTSW 2 158746665 critical splice donor site probably null
R1847:Ppp1r16b UTSW 2 158761435 missense probably damaging 0.99
R2297:Ppp1r16b UTSW 2 158761366 missense possibly damaging 0.88
R2509:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R2923:Ppp1r16b UTSW 2 158756957 missense probably damaging 1.00
R3907:Ppp1r16b UTSW 2 158761490 missense probably benign 0.00
R4344:Ppp1r16b UTSW 2 158749186 missense probably damaging 1.00
R4373:Ppp1r16b UTSW 2 158761765 missense probably damaging 1.00
R4423:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4424:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4425:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4623:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R5436:Ppp1r16b UTSW 2 158757333 intron probably benign
R6029:Ppp1r16b UTSW 2 158755217 missense possibly damaging 0.74
R6119:Ppp1r16b UTSW 2 158751127 missense probably benign 0.00
R6816:Ppp1r16b UTSW 2 158761675 missense probably benign 0.00
R6941:Ppp1r16b UTSW 2 158696148 missense probably damaging 1.00
R7101:Ppp1r16b UTSW 2 158761763 missense probably damaging 1.00
R7255:Ppp1r16b UTSW 2 158761391 missense probably benign 0.41
R7490:Ppp1r16b UTSW 2 158761468 missense probably damaging 0.99
X0064:Ppp1r16b UTSW 2 158751127 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATGAAGTCGCAGCTGAGG -3'
(R):5'- ATTAGCCACCAGACAGGAGC -3'

Sequencing Primer
(F):5'- AGCTGAGGCACAAGTCGTC -3'
(R):5'- CAGCTGCTTAAGGGCATCG -3'
Posted On2019-05-13