Incidental Mutation 'R7048:Rsrc1'
ID547413
Institutional Source Beutler Lab
Gene Symbol Rsrc1
Ensembl Gene ENSMUSG00000034544
Gene Namearginine/serine-rich coiled-coil 1
Synonyms1200013F24Rik, SRrp53
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location66981390-67358396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67180831 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000125468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046542] [ENSMUST00000065047] [ENSMUST00000065074] [ENSMUST00000161726] [ENSMUST00000162036] [ENSMUST00000162693]
Predicted Effect probably damaging
Transcript: ENSMUST00000046542
AA Change: D124G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047077
Gene: ENSMUSG00000034544
AA Change: D124G

DomainStartEndE-ValueType
low complexity region 3 116 N/A INTRINSIC
coiled coil region 138 191 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000065047
AA Change: D108G
SMART Domains Protein: ENSMUSP00000066967
Gene: ENSMUSG00000034544
AA Change: D108G

DomainStartEndE-ValueType
low complexity region 3 109 N/A INTRINSIC
coiled coil region 122 175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065074
AA Change: D166G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066797
Gene: ENSMUSG00000034544
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161726
AA Change: D166G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124347
Gene: ENSMUSG00000034544
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162036
AA Change: D166G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125468
Gene: ENSMUSG00000034544
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162693
AA Change: D164G

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125547
Gene: ENSMUSG00000034544
AA Change: D164G

DomainStartEndE-ValueType
low complexity region 3 88 N/A INTRINSIC
low complexity region 96 157 N/A INTRINSIC
coiled coil region 178 231 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine and arginine rich-related protein family. The encoded protein is involved in both constitutive and alternative mRNA splicing. This gene may be associated with schizophrenia. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Rsrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Rsrc1 APN 3 67082600 intron probably benign
IGL03180:Rsrc1 APN 3 67082543 intron probably benign
R0200:Rsrc1 UTSW 3 67180861 missense probably damaging 0.99
R0463:Rsrc1 UTSW 3 67180861 missense probably damaging 0.99
R1175:Rsrc1 UTSW 3 67356218 splice site probably benign
R1293:Rsrc1 UTSW 3 67356279 missense probably damaging 1.00
R1677:Rsrc1 UTSW 3 67355475 missense probably damaging 0.97
R1981:Rsrc1 UTSW 3 67350005 missense probably benign 0.18
R2039:Rsrc1 UTSW 3 66994618 missense unknown
R4222:Rsrc1 UTSW 3 66994567 missense unknown
R4624:Rsrc1 UTSW 3 67349978 missense probably damaging 1.00
R4852:Rsrc1 UTSW 3 67355602 missense probably damaging 1.00
R6102:Rsrc1 UTSW 3 66994649 missense unknown
R6103:Rsrc1 UTSW 3 66994649 missense unknown
R6104:Rsrc1 UTSW 3 66994649 missense unknown
R6127:Rsrc1 UTSW 3 66994649 missense unknown
R6129:Rsrc1 UTSW 3 66994649 missense unknown
R6153:Rsrc1 UTSW 3 67355562 missense probably benign 0.33
R6409:Rsrc1 UTSW 3 66994649 missense unknown
R6410:Rsrc1 UTSW 3 66994649 missense unknown
R6411:Rsrc1 UTSW 3 66994649 missense unknown
R6412:Rsrc1 UTSW 3 66994649 missense unknown
R6422:Rsrc1 UTSW 3 66994649 missense unknown
R6424:Rsrc1 UTSW 3 66994649 missense unknown
R6442:Rsrc1 UTSW 3 66994649 missense unknown
R6487:Rsrc1 UTSW 3 66994649 missense unknown
R6899:Rsrc1 UTSW 3 66994649 missense unknown
R6910:Rsrc1 UTSW 3 66994649 missense unknown
R6911:Rsrc1 UTSW 3 66994649 missense unknown
R6912:Rsrc1 UTSW 3 66994649 missense unknown
R6916:Rsrc1 UTSW 3 66994649 missense unknown
R6917:Rsrc1 UTSW 3 66994649 missense unknown
R6930:Rsrc1 UTSW 3 66994649 missense unknown
R6931:Rsrc1 UTSW 3 66994649 missense unknown
R6994:Rsrc1 UTSW 3 66994649 missense unknown
R6995:Rsrc1 UTSW 3 66994649 missense unknown
R6997:Rsrc1 UTSW 3 66994649 missense unknown
R7010:Rsrc1 UTSW 3 66994649 missense unknown
R7015:Rsrc1 UTSW 3 66994649 missense unknown
R7078:Rsrc1 UTSW 3 66994654 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAATGTAACTAAACGTACTGTGTG -3'
(R):5'- CTTCACGTACTAGCAGTAGGC -3'

Sequencing Primer
(F):5'- TGTAACTAAACGTACTGTGTGAATAC -3'
(R):5'- GGCTGAGCCTTTGGGAAATG -3'
Posted On2019-05-13