Incidental Mutation 'R7048:Rrnad1'
ID547414
Institutional Source Beutler Lab
Gene Symbol Rrnad1
Ensembl Gene ENSMUSG00000004896
Gene Nameribosomal RNA adenine dimethylase domain containing 1
SynonymsBC023814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87922601-87930717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87929860 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 36 (I36T)
Ref Sequence ENSEMBL: ENSMUSP00000131552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005016] [ENSMUST00000055984] [ENSMUST00000160074] [ENSMUST00000160143] [ENSMUST00000160648] [ENSMUST00000164439]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005016
AA Change: I36T

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005016
Gene: ENSMUSG00000004896
AA Change: I36T

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 293 1.5e-29 PFAM
low complexity region 385 402 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055984
SMART Domains Protein: ENSMUSP00000059783
Gene: ENSMUSG00000048039

DomainStartEndE-ValueType
low complexity region 128 145 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
EXOIII 193 359 3.34e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160074
SMART Domains Protein: ENSMUSP00000125365
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 69 229 1.3e-29 PFAM
low complexity region 321 338 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160143
AA Change: I36T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124113
Gene: ENSMUSG00000004896
AA Change: I36T

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 247 5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160648
AA Change: I36T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000164439
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Rrnad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1775:Rrnad1 UTSW 3 87923817 missense probably damaging 0.99
R2165:Rrnad1 UTSW 3 87927053 critical splice donor site probably null
R2307:Rrnad1 UTSW 3 87926855 missense possibly damaging 0.88
R3957:Rrnad1 UTSW 3 87926828 missense possibly damaging 0.82
R4651:Rrnad1 UTSW 3 87927672 missense probably benign
R4663:Rrnad1 UTSW 3 87927748 missense probably damaging 1.00
R4818:Rrnad1 UTSW 3 87924998 missense probably benign 0.32
R5387:Rrnad1 UTSW 3 87930011 intron probably benign
R5427:Rrnad1 UTSW 3 87924332 unclassified probably benign
R7032:Rrnad1 UTSW 3 87924342 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCAACTGTAGCATGGCC -3'
(R):5'- CATGGTTTCGTGGTACCGAC -3'

Sequencing Primer
(F):5'- CAACTGTAGCATGGCCAAATGTTG -3'
(R):5'- GGTACCGACCTTGTGTCTC -3'
Posted On2019-05-13