Incidental Mutation 'R7048:Gpsm2'
ID547416
Institutional Source Beutler Lab
Gene Symbol Gpsm2
Ensembl Gene ENSMUSG00000027883
Gene NameG-protein signalling modulator 2 (AGS3-like, C. elegans)
SynonymsLGN, 6230410J09Rik, Pins
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108678638-108722309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108703045 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 33 (R33H)
Ref Sequence ENSEMBL: ENSMUSP00000029482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029482] [ENSMUST00000145558]
PDB Structure
Structures of the LGN/NuMA complex [X-RAY DIFFRACTION]
crystal structure of LGN/mInscuteable complex [X-RAY DIFFRACTION]
Structure complex of LGN binding with FRMPD1 [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai3(Q147L) complex [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai1 complex [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai3 complex [X-RAY DIFFRACTION]
Structure of LGN GL3/Galphai3 complex [X-RAY DIFFRACTION]
An auto-inhibited conformation of LGN reveals a distinct interaction mode between GoLoco motifs and TPR motifs [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029482
AA Change: R33H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029482
Gene: ENSMUSG00000027883
AA Change: R33H

DomainStartEndE-ValueType
TPR 62 95 7.86e-3 SMART
TPR 102 135 4.34e-5 SMART
Blast:TPR 142 188 9e-22 BLAST
TPR 202 235 1.69e-2 SMART
TPR 242 275 3.99e-4 SMART
TPR 282 315 1.51e-4 SMART
TPR 322 355 1.04e-2 SMART
GoLoco 490 512 3.69e-9 SMART
low complexity region 518 527 N/A INTRINSIC
GoLoco 543 565 7.27e-8 SMART
GoLoco 594 616 2.31e-10 SMART
GoLoco 628 650 2.75e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124043
Predicted Effect probably damaging
Transcript: ENSMUST00000145558
AA Change: R33H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115759
Gene: ENSMUSG00000027883
AA Change: R33H

DomainStartEndE-ValueType
Blast:TPR 24 57 1e-10 BLAST
Pfam:TPR_8 61 84 1.5e-2 PFAM
Pfam:TPR_10 61 101 3.6e-5 PFAM
Pfam:TPR_1 62 86 7.6e-6 PFAM
Pfam:TPR_2 62 94 2e-5 PFAM
Pfam:TPR_7 64 99 1e-4 PFAM
Pfam:TPR_12 101 154 4.6e-10 PFAM
Pfam:TPR_2 102 134 7e-4 PFAM
Pfam:TPR_1 102 135 2.2e-8 PFAM
Pfam:TPR_8 102 136 5.8e-3 PFAM
Pfam:TPR_7 104 139 4.3e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154263
Meta Mutation Damage Score 0.4972 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that modulate activation of G proteins, which transduce extracellular signals received by cell surface receptors into integrated cellular responses. The N-terminal half of this protein contains 10 copies of leu-gly-asn (LGN) repeat, and the C-terminal half contains 4 GoLoco motifs, which are involved in guanine nucleotide exchange. This protein may play a role in neuroblast division and in the development of normal hearing. Mutations in this gene are associated with autosomal recessive nonsyndromic deafness (DFNB82). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Targeted disruption of this gene randomizes the spindle orientation of normally planar neuroepithelial divisions. The ensuing loss of the apical membrane from daughter cells frequently converts them into abnormally localized progenitors with no apparent effect on neuronal production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Gpsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Gpsm2 APN 3 108696987 missense probably benign 0.00
IGL01754:Gpsm2 APN 3 108703045 missense probably damaging 1.00
IGL02624:Gpsm2 APN 3 108682033 missense probably benign 0.01
IGL03005:Gpsm2 APN 3 108687006 splice site probably benign
R0482:Gpsm2 UTSW 3 108702394 splice site probably benign
R1793:Gpsm2 UTSW 3 108700909 missense probably benign 0.14
R1796:Gpsm2 UTSW 3 108701850 missense probably damaging 0.99
R4174:Gpsm2 UTSW 3 108702509 missense probably damaging 1.00
R7325:Gpsm2 UTSW 3 108702928 missense probably damaging 1.00
R7400:Gpsm2 UTSW 3 108679688 missense probably damaging 1.00
R7574:Gpsm2 UTSW 3 108700745 missense probably damaging 0.98
R7657:Gpsm2 UTSW 3 108700745 missense probably damaging 0.98
R7709:Gpsm2 UTSW 3 108701781 missense probably benign 0.08
Z1088:Gpsm2 UTSW 3 108700760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGCAAGAGTTAAGTCATGG -3'
(R):5'- AATCGGAGTAGGCACATTGGC -3'

Sequencing Primer
(F):5'- AAGTCATGGTGGTGGTATTCTAAC -3'
(R):5'- GCACATTGGCTGTTGCTAC -3'
Posted On2019-05-13