Incidental Mutation 'R7048:Ubap2'
ID547420
Institutional Source Beutler Lab
Gene Symbol Ubap2
Ensembl Gene ENSMUSG00000028433
Gene Nameubiquitin-associated protein 2
Synonyms1190005K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41194313-41275144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41196033 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 949 (T949I)
Ref Sequence ENSEMBL: ENSMUSP00000103703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000040008] [ENSMUST00000108068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030143
AA Change: T950I

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: T950I

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040008
SMART Domains Protein: ENSMUSP00000038813
Gene: ENSMUSG00000036241

DomainStartEndE-ValueType
UBCc 11 174 1.55e-65 SMART
low complexity region 204 232 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108068
AA Change: T949I

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: T949I

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136057
SMART Domains Protein: ENSMUSP00000120205
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 49 70 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Ubap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2 APN 4 41195328 splice site probably benign
IGL01109:Ubap2 APN 4 41195155 missense probably damaging 1.00
IGL01354:Ubap2 APN 4 41207005 missense probably damaging 1.00
IGL01563:Ubap2 APN 4 41195998 missense probably damaging 0.96
IGL01602:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01605:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01688:Ubap2 APN 4 41226308 missense probably benign
IGL01733:Ubap2 APN 4 41195862 unclassified probably benign
IGL01896:Ubap2 APN 4 41202362 missense possibly damaging 0.85
IGL01942:Ubap2 APN 4 41251608 missense probably benign 0.00
IGL02095:Ubap2 APN 4 41229709 missense probably benign
R0608:Ubap2 UTSW 4 41218319 missense probably benign 0.10
R0938:Ubap2 UTSW 4 41202304 missense probably damaging 1.00
R1449:Ubap2 UTSW 4 41209351 critical splice donor site probably null
R1484:Ubap2 UTSW 4 41235593 missense probably damaging 1.00
R1548:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1549:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1604:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1607:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1739:Ubap2 UTSW 4 41206849 missense probably benign 0.00
R1772:Ubap2 UTSW 4 41202380 missense probably benign 0.02
R1862:Ubap2 UTSW 4 41221607 missense probably benign
R1869:Ubap2 UTSW 4 41233617 missense probably damaging 1.00
R1886:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1887:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2063:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2064:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2065:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2066:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2095:Ubap2 UTSW 4 41206901 missense possibly damaging 0.68
R2214:Ubap2 UTSW 4 41199714 critical splice donor site probably null
R2215:Ubap2 UTSW 4 41196483 splice site probably null
R2318:Ubap2 UTSW 4 41251542 missense probably damaging 0.99
R3755:Ubap2 UTSW 4 41195482 missense probably damaging 1.00
R4620:Ubap2 UTSW 4 41233698 missense probably damaging 1.00
R4717:Ubap2 UTSW 4 41218333 missense possibly damaging 0.93
R4756:Ubap2 UTSW 4 41211771 missense probably damaging 1.00
R4942:Ubap2 UTSW 4 41245461 intron probably benign
R5344:Ubap2 UTSW 4 41251578 missense possibly damaging 0.46
R5763:Ubap2 UTSW 4 41195809 missense probably damaging 1.00
R5851:Ubap2 UTSW 4 41206268 nonsense probably null
R5951:Ubap2 UTSW 4 41205753 splice site probably null
R6178:Ubap2 UTSW 4 41206981 missense probably benign
R6489:Ubap2 UTSW 4 41203574 critical splice acceptor site probably null
R6520:Ubap2 UTSW 4 41195155 missense probably damaging 1.00
R6652:Ubap2 UTSW 4 41196743 missense possibly damaging 0.68
R6702:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227224 small insertion probably benign
R6860:Ubap2 UTSW 4 41233631 missense probably damaging 1.00
R7007:Ubap2 UTSW 4 41206221 missense probably damaging 0.97
R7121:Ubap2 UTSW 4 41205550 missense probably benign 0.00
R7371:Ubap2 UTSW 4 41195779 missense probably benign 0.16
R7378:Ubap2 UTSW 4 41235515 critical splice donor site probably null
R7695:Ubap2 UTSW 4 41211740 missense probably damaging 0.98
R7811:Ubap2 UTSW 4 41211710 missense probably benign 0.22
R7828:Ubap2 UTSW 4 41221615 missense probably benign 0.00
R7838:Ubap2 UTSW 4 41233655 missense probably damaging 1.00
R8016:Ubap2 UTSW 4 41195201 missense possibly damaging 0.91
X0061:Ubap2 UTSW 4 41196507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGGGTCAAATCGTCATAAC -3'
(R):5'- TTGAGTTGCAGCCAGCCTTG -3'

Sequencing Primer
(F):5'- CTGGGTCAAATCGTCATAACCTAGG -3'
(R):5'- AGCCAGCCTTGGTTCAGG -3'
Posted On2019-05-13