Incidental Mutation 'R7048:Mest'
ID547428
Institutional Source Beutler Lab
Gene Symbol Mest
Ensembl Gene ENSMUSG00000051855
Gene Namemesoderm specific transcript
SynonymsPeg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location30723547-30748465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 30742724 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 108 (H108Q)
Ref Sequence ENSEMBL: ENSMUSP00000120408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048774] [ENSMUST00000115127] [ENSMUST00000124665] [ENSMUST00000147400] [ENSMUST00000151777] [ENSMUST00000157040] [ENSMUST00000163949]
Predicted Effect probably benign
Transcript: ENSMUST00000048774
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115127
SMART Domains Protein: ENSMUSP00000110780
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 23 107 3e-9 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117713
Gene: ENSMUSG00000051855
AA Change: H123Q

DomainStartEndE-ValueType
Pfam:DUF1057 50 183 3.9e-9 PFAM
Pfam:Abhydrolase_6 79 198 7.8e-21 PFAM
Pfam:Abhydrolase_1 104 191 4.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147400
AA Change: H108Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120408
Gene: ENSMUSG00000051855
AA Change: H108Q

DomainStartEndE-ValueType
Pfam:DUF1057 35 144 3.3e-9 PFAM
Pfam:Abhydrolase_6 64 145 3.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151777
SMART Domains Protein: ENSMUSP00000115541
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 42 133 1e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000157040
AA Change: H107Q

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119038
Gene: ENSMUSG00000051855
AA Change: H107Q

DomainStartEndE-ValueType
Pfam:DUF1057 34 167 3.1e-9 PFAM
Pfam:Abhydrolase_6 63 182 6.2e-21 PFAM
Pfam:Abhydrolase_1 88 176 4e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163949
AA Change: H116Q

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129639
Gene: ENSMUSG00000051855
AA Change: H116Q

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:DUF1057 43 176 7.1e-9 PFAM
Pfam:Abhydrolase_1 70 321 2.5e-16 PFAM
Pfam:Abhydrolase_5 71 315 5.9e-9 PFAM
Pfam:Abhydrolase_6 72 327 7.1e-13 PFAM
Meta Mutation Damage Score 0.1822 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retardation of embryonic growth and subtle cardiac abnormalities associated with reduced postnatal survival rates. Mutant females exhibit abnormal maternal behavior and impaired placentophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Mest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Mest APN 6 30746331 unclassified probably benign
IGL02231:Mest APN 6 30740773 missense possibly damaging 0.93
IGL02386:Mest APN 6 30744914 missense possibly damaging 0.65
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0826:Mest UTSW 6 30742814 missense probably damaging 1.00
R0972:Mest UTSW 6 30740684 nonsense probably null
R1580:Mest UTSW 6 30745823 unclassified probably benign
R1768:Mest UTSW 6 30745139 missense probably benign 0.01
R1835:Mest UTSW 6 30742791 missense probably benign 0.14
R2131:Mest UTSW 6 30745885 missense probably damaging 1.00
R3918:Mest UTSW 6 30742750 missense probably benign 0.07
R3919:Mest UTSW 6 30742750 missense probably benign 0.07
R4544:Mest UTSW 6 30740680 missense probably damaging 1.00
R4546:Mest UTSW 6 30740680 missense probably damaging 1.00
R4647:Mest UTSW 6 30745110 nonsense probably null
R6818:Mest UTSW 6 30746287 missense probably damaging 1.00
R7158:Mest UTSW 6 30744914 missense possibly damaging 0.65
R7290:Mest UTSW 6 30747159 missense unknown
R7734:Mest UTSW 6 30746300 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGTGCTCACCATGCTTG -3'
(R):5'- TAAAGCTACGACACCTGTGCAG -3'

Sequencing Primer
(F):5'- CTTTCTTAACAGATCTGGGAAGGGC -3'
(R):5'- TACGACACCTGTGCAGAGGAC -3'
Posted On2019-05-13