Incidental Mutation 'R7048:Cyp2r1'
ID547438
Institutional Source Beutler Lab
Gene Symbol Cyp2r1
Ensembl Gene ENSMUSG00000030670
Gene Namecytochrome P450, family 2, subfamily r, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location114549682-114562972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114552736 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 120 (Y120N)
Ref Sequence ENSEMBL: ENSMUSP00000147544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032908] [ENSMUST00000119712] [ENSMUST00000128587] [ENSMUST00000138712] [ENSMUST00000147428] [ENSMUST00000211506]
Predicted Effect probably damaging
Transcript: ENSMUST00000032908
AA Change: Y329N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032908
Gene: ENSMUSG00000030670
AA Change: Y329N

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:p450 40 498 7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119712
SMART Domains Protein: ENSMUSP00000112818
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 40 124 2.3e-15 PFAM
Pfam:p450 115 287 1.8e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128587
AA Change: Y254N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121924
Gene: ENSMUSG00000030670
AA Change: Y254N

DomainStartEndE-ValueType
Pfam:p450 1 260 5.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138712
SMART Domains Protein: ENSMUSP00000123556
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000147428
SMART Domains Protein: ENSMUSP00000119605
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000211506
AA Change: Y120N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4662 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a microsomal vitamin D hydroxylase that converts vitamin D into the active ligand for the vitamin D receptor. A mutation in this gene has been associated with selective 25-hydroxyvitamin D deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more than a 50% reduction in serum 25-hydroxyvitamin D3 levels but remain healthy and show normal serum 1alpha,25-dihydroxyvitamin D3 levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Cyp2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Cyp2r1 APN 7 114551826 missense probably benign 0.00
IGL01515:Cyp2r1 APN 7 114552712 splice site probably benign
R0178:Cyp2r1 UTSW 7 114550408 missense probably damaging 1.00
R0518:Cyp2r1 UTSW 7 114552900 missense probably benign 0.01
R0686:Cyp2r1 UTSW 7 114552011 missense possibly damaging 0.52
R1772:Cyp2r1 UTSW 7 114553216 missense probably damaging 0.99
R2044:Cyp2r1 UTSW 7 114550405 missense probably damaging 0.98
R3785:Cyp2r1 UTSW 7 114554696 missense possibly damaging 0.69
R6248:Cyp2r1 UTSW 7 114562731 critical splice donor site probably null
R6995:Cyp2r1 UTSW 7 114553081 missense probably damaging 1.00
R7063:Cyp2r1 UTSW 7 114552949 missense probably damaging 1.00
R7538:Cyp2r1 UTSW 7 114562767 missense probably damaging 1.00
R7549:Cyp2r1 UTSW 7 114554644 missense possibly damaging 0.58
R7680:Cyp2r1 UTSW 7 114552819 missense probably damaging 1.00
R7882:Cyp2r1 UTSW 7 114554589 critical splice donor site probably null
R7965:Cyp2r1 UTSW 7 114554589 critical splice donor site probably null
Z1088:Cyp2r1 UTSW 7 114551974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCCACATACTCAGCCTG -3'
(R):5'- CAGTCAATAGAAAGCCTCATTTACCTC -3'

Sequencing Primer
(F):5'- TTCCTTCCTTTTCCTTAAATCTGC -3'
(R):5'- CACCATTTTGTTGATGCCTATTTAG -3'
Posted On2019-05-13