Incidental Mutation 'R7048:Syce1'
ID547440
Institutional Source Beutler Lab
Gene Symbol Syce1
Ensembl Gene ENSMUSG00000025480
Gene Namesynaptonemal complex central element protein 1
Synonyms4933406J07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140777229-140787852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140779368 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 147 (D147N)
Ref Sequence ENSEMBL: ENSMUSP00000026553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000026553] [ENSMUST00000209253] [ENSMUST00000210235] [ENSMUST00000211616]
Predicted Effect probably benign
Transcript: ENSMUST00000026552
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000026553
AA Change: D147N

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026553
Gene: ENSMUSG00000025480
AA Change: D147N

DomainStartEndE-ValueType
Pfam:SYCE1 49 200 5.5e-66 PFAM
coiled coil region 237 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209253
Predicted Effect probably benign
Transcript: ENSMUST00000210235
Predicted Effect probably benign
Transcript: ENSMUST00000211616
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptonemal complex, which links homologous chromosomes during prophase I of meiosis. The tripartite structure of the complex is highly conserved amongst metazoans. It consists of two lateral elements and a central region formed by transverse elements and a central element. The protein encoded by this gene localizes to the central element and is required for initiation and elongation of the synapsis. Allelic variants of this gene have been associated with premature ovarian failure and spermatogenic failure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit small ovaries and small testes, severe defects in gametogenesis, and infertility in both sexes. Meiosis is arrested, homologous chromosomes fail to synapse, and meiotic double-strand breaks are formed but are notefficiently repaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Syce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02112:Syce1 APN 7 140779632 missense probably benign
IGL03304:Syce1 APN 7 140777710 missense possibly damaging 0.67
R0918:Syce1 UTSW 7 140780523 missense probably damaging 1.00
R1106:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R1169:Syce1 UTSW 7 140778207 missense probably benign 0.00
R1430:Syce1 UTSW 7 140779438 unclassified probably benign
R1436:Syce1 UTSW 7 140777680 missense possibly damaging 0.84
R1650:Syce1 UTSW 7 140778387 missense possibly damaging 0.62
R2081:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R2082:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3890:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3891:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4006:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4007:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4077:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4078:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4079:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4817:Syce1 UTSW 7 140778423 missense probably benign 0.00
R4824:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R5040:Syce1 UTSW 7 140779065 missense probably damaging 1.00
R5766:Syce1 UTSW 7 140777981 missense probably damaging 1.00
R6380:Syce1 UTSW 7 140779065 missense probably damaging 1.00
Y4338:Syce1 UTSW 7 140779896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAGCACCCAAGGACTTCGTG -3'
(R):5'- AGAGGTAAGATGCCATGCCTG -3'

Sequencing Primer
(F):5'- GTGTCCACTCTTACACAAGGAATAG -3'
(R):5'- TAAGATGCCATGCCTGCAGTG -3'
Posted On2019-05-13