Incidental Mutation 'R7048:Trim42'
ID547444
Institutional Source Beutler Lab
Gene Symbol Trim42
Ensembl Gene ENSMUSG00000032451
Gene Nametripartite motif-containing 42
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location97349562-97369958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97363421 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 442 (F442Y)
Ref Sequence ENSEMBL: ENSMUSP00000035026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035026]
Predicted Effect probably damaging
Transcript: ENSMUST00000035026
AA Change: F442Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035026
Gene: ENSMUSG00000032451
AA Change: F442Y

DomainStartEndE-ValueType
RING 146 191 3.67e-3 SMART
BBOX 233 280 1.42e0 SMART
BBOX 285 326 1.04e-2 SMART
low complexity region 386 399 N/A INTRINSIC
FN3 603 688 2.44e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, namely a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Trim42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02289:Trim42 APN 9 97359233 missense probably damaging 0.97
IGL02987:Trim42 APN 9 97365815 missense probably benign 0.28
R0116:Trim42 UTSW 9 97363403 missense possibly damaging 0.89
R0791:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R1170:Trim42 UTSW 9 97363620 missense probably benign 0.04
R1397:Trim42 UTSW 9 97365621 missense probably damaging 1.00
R1499:Trim42 UTSW 9 97366085 missense possibly damaging 0.95
R1522:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R2094:Trim42 UTSW 9 97366097 missense probably benign 0.23
R2355:Trim42 UTSW 9 97359240 missense probably damaging 1.00
R4621:Trim42 UTSW 9 97363148 missense probably benign
R4649:Trim42 UTSW 9 97362945 missense probably benign 0.00
R4840:Trim42 UTSW 9 97362929 missense probably benign 0.02
R6147:Trim42 UTSW 9 97363329 missense probably benign
R7235:Trim42 UTSW 9 97369708 missense probably damaging 0.99
R7276:Trim42 UTSW 9 97369572 nonsense probably null
R7390:Trim42 UTSW 9 97359129 missense probably damaging 1.00
R7442:Trim42 UTSW 9 97362945 missense probably damaging 0.97
R7650:Trim42 UTSW 9 97363148 missense probably benign
Z1088:Trim42 UTSW 9 97369622 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCGATCATCATTTCTGAGTGG -3'
(R):5'- ACTGCGAGCCATCCTTCAAG -3'

Sequencing Primer
(F):5'- CGATCATCATTTCTGAGTGGATAGG -3'
(R):5'- GCGAGCCATCCTTCAAGAGAAAG -3'
Posted On2019-05-13