Incidental Mutation 'R7048:Dnajc13'
ID547445
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 104203414 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
Predicted Effect probably null
Transcript: ENSMUST00000035170
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185503
Predicted Effect probably null
Transcript: ENSMUST00000186788
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCGTAAACGATAGCAAGG -3'
(R):5'- GGTCTAGACAAGATGGCAAATTCC -3'

Sequencing Primer
(F):5'- GGGCTTGTAAACACAAACACTTCATG -3'
(R):5'- ATATGAGTGCCTGGCAGA -3'
Posted On2019-05-13