Incidental Mutation 'R7048:Phactr2'
ID547446
Institutional Source Beutler Lab
Gene Symbol Phactr2
Ensembl Gene ENSMUSG00000062866
Gene Namephosphatase and actin regulator 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location13207717-13474412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13245424 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 444 (T444S)
Ref Sequence ENSEMBL: ENSMUSP00000101182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079698] [ENSMUST00000105543] [ENSMUST00000105545] [ENSMUST00000105546]
Predicted Effect
SMART Domains Protein: ENSMUSP00000078637
Gene: ENSMUSG00000062866
AA Change: T437S

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 154 179 N/A INTRINSIC
low complexity region 208 218 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
low complexity region 378 388 N/A INTRINSIC
RPEL 403 428 5.81e-8 SMART
RPEL 441 466 1.36e-8 SMART
RPEL 479 504 1.64e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105543
AA Change: T444S

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101182
Gene: ENSMUSG00000062866
AA Change: T444S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 165 190 N/A INTRINSIC
low complexity region 219 229 N/A INTRINSIC
low complexity region 261 281 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
RPEL 414 439 5.81e-8 SMART
RPEL 452 477 1.36e-8 SMART
RPEL 490 515 1.64e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105545
AA Change: T507S

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101184
Gene: ENSMUSG00000062866
AA Change: T507S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 157 182 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 253 273 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
RPEL 406 431 5.81e-8 SMART
RPEL 444 469 1.36e-8 SMART
RPEL 482 507 1.64e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105546
AA Change: T513S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101185
Gene: ENSMUSG00000062866
AA Change: T513S

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 133 144 N/A INTRINSIC
low complexity region 149 184 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
low complexity region 226 251 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
low complexity region 322 342 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
RPEL 475 500 5.81e-8 SMART
RPEL 513 538 1.36e-8 SMART
RPEL 551 576 1.64e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Olfr113 A T 17: 37,575,223 S67T probably damaging Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Phactr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Phactr2 APN 10 13245535 missense probably damaging 1.00
IGL01844:Phactr2 APN 10 13253437 missense probably benign 0.05
IGL01893:Phactr2 APN 10 13247188 missense probably benign 0.38
IGL02458:Phactr2 APN 10 13261828 missense probably damaging 1.00
IGL02612:Phactr2 APN 10 13245423 missense probably damaging 0.99
IGL02620:Phactr2 APN 10 13291888 missense probably damaging 1.00
IGL03064:Phactr2 APN 10 13388713 utr 5 prime probably benign
IGL03493:Phactr2 APN 10 13257669 missense probably benign 0.02
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0974:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R1480:Phactr2 UTSW 10 13253792 missense possibly damaging 0.74
R3115:Phactr2 UTSW 10 13261901 nonsense probably null
R3116:Phactr2 UTSW 10 13261901 nonsense probably null
R3713:Phactr2 UTSW 10 13388732 start gained probably benign
R4367:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R4368:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R4371:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R5344:Phactr2 UTSW 10 13253616 missense possibly damaging 0.76
R5491:Phactr2 UTSW 10 13261846 missense possibly damaging 0.91
R5617:Phactr2 UTSW 10 13474065 missense possibly damaging 0.60
R5656:Phactr2 UTSW 10 13388703 missense probably benign 0.34
R5895:Phactr2 UTSW 10 13245517 missense probably damaging 1.00
R6051:Phactr2 UTSW 10 13261811 unclassified probably null 0.00
R6317:Phactr2 UTSW 10 13261882 missense probably damaging 0.98
R7101:Phactr2 UTSW 10 13247178 missense probably benign 0.00
R7221:Phactr2 UTSW 10 13247039 missense possibly damaging 0.58
RF023:Phactr2 UTSW 10 13245434 missense probably benign 0.10
X0026:Phactr2 UTSW 10 13257634 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGCTCTTAAAGGTACTGAAC -3'
(R):5'- CCTGTTCAAGTCCAGCCATG -3'

Sequencing Primer
(F):5'- GCTCTTAAAGGTACTGAACAACTGAC -3'
(R):5'- GCCCTGCTAAGGTTAACACTG -3'
Posted On2019-05-13