Mutagenetix > Incidental Mutations

Incidental Mutation 'R7048:Cd180'

547456

Institutional Source

Beutler Lab

Gene Symbol

Cd180

Ensembl Gene

ENSMUSG00000021624

Gene Name

CD180 antigen

Synonyms

Ly78, RP105

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7048 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102693558-102739629 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102704923 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 159 (N159S)

Ref Sequence

ENSEMBL: ENSMUSP00000022124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]

PDB Structure

Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022124
AA Change: N159S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: N159S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LRR	76	99	1.07e0	SMART
LRR	193	221	1.76e2	SMART
LRR	297	320	1.66e1	SMART
Pfam:LRR_8	321	382	4.2e-13	PFAM
LRR	395	418	3e1	SMART
LRR	444	467	3.09e1	SMART
LRR	495	518	4.97e0	SMART
LRR	519	542	2.4e1	SMART
low complexity region	555	567	N/A	INTRINSIC
LRRCT	577	626	5.11e-8	SMART
transmembrane domain	628	650	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000167144
AA Change: T54A

SMART Domains

Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624
AA Change: T54A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000171267

SMART Domains

Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	2e-38	PDB
SCOP:d1m0za_	35	84	9e-4	SMART
Blast:LRR	51	75	7e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Meta Mutation Damage Score

0.5086

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,846,929	D629G	probably damaging	Het
Akap11	T	A	14: 78,512,514	Q811L		Het
Ank2	T	A	3: 127,025,618	Q468L	probably benign	Het
Ano3	A	T	2: 110,682,771	Y626*	probably null	Het
Ap1m1	A	G	8: 72,249,798	N114S	probably damaging	Het
Asb3	T	A	11: 31,101,121	I525N	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,356	I223T	probably damaging	Het
B3gnt7	T	C	1: 86,305,586	Y68H	probably benign	Het
Bbs5	T	C	2: 69,654,361	I125T	probably benign	Het
Cd37	T	C	7: 45,238,464		probably benign	Het
Cdk14	T	A	5: 5,093,005	Q242L	probably damaging	Het
Clcn1	T	C	6: 42,307,543	V605A	probably damaging	Het
Cped1	G	A	6: 22,119,470	M309I	probably benign	Het
Cyp2r1	A	T	7: 114,552,736	Y120N	probably damaging	Het
Ddx3y	A	T	Y: 1,279,491	S124R	probably benign	Het
Dlec1	A	T	9: 119,143,404		probably null	Het
Dnah17	T	C	11: 118,046,118	E3420G	possibly damaging	Het
Dnajc13	C	T	9: 104,203,414		probably null	Het
Dusp23	A	T	1: 172,631,686	Y136*	probably null	Het
Eif4b	A	G	15: 102,093,136		probably benign	Het
F13a1	A	G	13: 36,898,143	V529A	probably benign	Het
Fhl2	A	G	1: 43,123,648	Y236H	probably damaging	Het
Gm826	C	T	2: 160,327,106	W94*	probably null	Het
Gpsm2	C	T	3: 108,703,045	R33H	probably damaging	Het
Hmcn1	T	C	1: 150,599,653		probably null	Het
Ifit1bl2	T	C	19: 34,619,151	D355G	probably benign	Het
Itga8	A	G	2: 12,111,084	V77A	probably damaging	Het
Kcmf1	C	T	6: 72,849,467	R40K	probably damaging	Het
Kdm7a	T	C	6: 39,169,048	E315G	probably damaging	Het
Kmt2b	C	T	7: 30,569,306	G2666D	probably damaging	Het
Lrrtm1	A	G	6: 77,244,169	N203S	probably damaging	Het
Mdn1	A	G	4: 32,767,969	N5301D	probably benign	Het
Mest	T	G	6: 30,742,724	H108Q	probably damaging	Het
Moxd1	C	A	10: 24,281,476	D335E	probably damaging	Het
Ncf2	A	C	1: 152,808,170	N47H	probably benign	Het
Npc1	A	G	18: 12,204,765		probably null	Het
Olfr113	A	T	17: 37,575,223	S67T	probably damaging	Het
Pcid2	A	G	8: 13,078,243	V386A	probably benign	Het
Phactr2	T	A	10: 13,245,424	T444S	probably benign	Het
Plekha7	T	C	7: 116,148,324	N710D	probably benign	Het
Ppp1r16b	C	T	2: 158,757,254	T382I	probably benign	Het
Pramef20	T	C	4: 144,377,184	D124G	probably benign	Het
Ptprz1	A	T	6: 22,961,623	Y111F	probably benign	Het
Rbbp8	A	G	18: 11,732,220	E722G	possibly damaging	Het
Rimbp3	A	G	16: 17,210,326	D538G	probably benign	Het
Rims1	A	G	1: 22,472,820	S551P	probably damaging	Het
Rrnad1	A	G	3: 87,929,860	I36T	probably damaging	Het
Rsrc1	A	G	3: 67,180,831	D166G	probably damaging	Het
Selenon	T	C	4: 134,542,843	N350S	probably benign	Het
Sh3gl2	T	A	4: 85,377,565	L168H	probably damaging	Het
Smc3	T	C	19: 53,629,251	Y560H	probably benign	Het
Syce1	C	T	7: 140,779,368	D147N	possibly damaging	Het
Syt10	A	C	15: 89,790,805	V446G	probably damaging	Het
Taar1	T	C	10: 23,920,824	L140P	probably benign	Het
Tfpi2	C	A	6: 3,968,032	C36F	probably damaging	Het
Thoc5	G	A	11: 4,926,237		probably null	Het
Tnrc6c	T	A	11: 117,721,974	N319K	probably benign	Het
Trhr2	C	T	8: 122,358,679	D189N	probably damaging	Het
Trim42	A	T	9: 97,363,421	F442Y	probably damaging	Het
Ubap2	G	A	4: 41,196,033	T949I	possibly damaging	Het
Ugt1a8	T	C	1: 88,088,302	F146L	probably benign	Het
Vmn2r80	C	A	10: 79,194,319	Q660K	probably damaging	Het
Vstm2b	C	T	7: 40,929,376	T258I	possibly damaging	Het
Washc2	T	C	6: 116,220,583	L259P	possibly damaging	Het
Zscan18	A	T	7: 12,774,744		probably benign	Het
Zzef1	T	G	11: 72,866,699	Y1193*	probably null	Het

Other mutations in Cd180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cd180	APN	13	102705409	missense	probably benign
IGL00949:Cd180	APN	13	102693760	missense	possibly damaging	0.89
IGL01864:Cd180	APN	13	102706033	missense	possibly damaging	0.93
IGL01901:Cd180	APN	13	102706428	missense	probably benign	0.04
IGL01934:Cd180	APN	13	102702858	missense	probably damaging	1.00
IGL01998:Cd180	APN	13	102705214	missense	probably damaging	0.99
IGL02336:Cd180	APN	13	102705313	missense	probably damaging	0.98
IGL03031:Cd180	APN	13	102705027	missense	probably benign	0.00
IGL03139:Cd180	APN	13	102706416	missense	probably damaging	1.00
Volte_face	UTSW	13	102704923	missense	probably damaging	0.99
H8562:Cd180	UTSW	13	102705418	missense	probably benign	0.02
R0004:Cd180	UTSW	13	102702708	missense	probably benign	0.00
R0393:Cd180	UTSW	13	102705900	missense	probably damaging	0.99
R0565:Cd180	UTSW	13	102702874	intron	probably benign
R1080:Cd180	UTSW	13	102706220	nonsense	probably null
R1223:Cd180	UTSW	13	102706222	missense	possibly damaging	0.49
R1669:Cd180	UTSW	13	102705490	missense	probably damaging	1.00
R1772:Cd180	UTSW	13	102706242	missense	probably benign	0.11
R1784:Cd180	UTSW	13	102705859	missense	probably damaging	1.00
R1865:Cd180	UTSW	13	102706009	missense	probably benign
R2252:Cd180	UTSW	13	102706398	nonsense	probably null
R2385:Cd180	UTSW	13	102705183	missense	probably benign	0.00
R4653:Cd180	UTSW	13	102704908	missense	probably damaging	1.00
R4695:Cd180	UTSW	13	102705760	missense	probably benign	0.01
R4790:Cd180	UTSW	13	102702822	missense	probably damaging	0.98
R4934:Cd180	UTSW	13	102739164	critical splice acceptor site	probably null
R5052:Cd180	UTSW	13	102704895	missense	probably benign
R5154:Cd180	UTSW	13	102705774	missense	probably damaging	1.00
R5469:Cd180	UTSW	13	102704834	missense	probably benign	0.37
R5493:Cd180	UTSW	13	102706141	missense	probably benign	0.07
R5615:Cd180	UTSW	13	102706203	missense	probably benign	0.34
R5905:Cd180	UTSW	13	102706033	missense	possibly damaging	0.93
R6282:Cd180	UTSW	13	102693757	missense	possibly damaging	0.90
R6433:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R6456:Cd180	UTSW	13	102702836	missense	probably damaging	1.00
R6784:Cd180	UTSW	13	102702705	missense	probably damaging	0.97
R6815:Cd180	UTSW	13	102705429	missense	probably damaging	1.00
R6838:Cd180	UTSW	13	102702731	missense	probably benign	0.38
R6941:Cd180	UTSW	13	102706191	missense	probably benign	0.23
R7338:Cd180	UTSW	13	102706428	missense	probably benign	0.04
R7466:Cd180	UTSW	13	102704995	missense	probably damaging	1.00
R7647:Cd180	UTSW	13	102705943	missense	probably damaging	1.00
R8179:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R8252:Cd180	UTSW	13	102705996	missense	probably benign	0.00
R8300:Cd180	UTSW	13	102704793	missense	probably benign	0.01
R8460:Cd180	UTSW	13	102702846	missense	probably damaging	1.00
Z1176:Cd180	UTSW	13	102705766	missense	probably damaging	1.00
Z1177:Cd180	UTSW	13	102706032	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GGTTAGACACACTTGTACTAACCG -3'
(R):5'- TAGCAAGTTCTGAGTCCCTCC -3'

Sequencing Primer
(F):5'- CGCAAATCCCCTGATATTTATGGCAG -3'
(R):5'- CTTTGGAAGACAGCTGAGTCG -3'

Posted On

2019-05-13