Incidental Mutation 'R7048:Olfr113'
ID547461
Institutional Source Beutler Lab
Gene Symbol Olfr113
Ensembl Gene ENSMUSG00000092292
Gene Nameolfactory receptor 113
SynonymsGA_x6K02T2PSCP-2034880-2033942, MOR218-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R7048 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37573877-37577663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37575223 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 67 (S67T)
Ref Sequence ENSEMBL: ENSMUSP00000149739 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000216181
AA Change: S67T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5117 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,846,929 D629G probably damaging Het
Akap11 T A 14: 78,512,514 Q811L Het
Ank2 T A 3: 127,025,618 Q468L probably benign Het
Ano3 A T 2: 110,682,771 Y626* probably null Het
Ap1m1 A G 8: 72,249,798 N114S probably damaging Het
Asb3 T A 11: 31,101,121 I525N probably damaging Het
Atg4a-ps A G 3: 103,645,356 I223T probably damaging Het
B3gnt7 T C 1: 86,305,586 Y68H probably benign Het
Bbs5 T C 2: 69,654,361 I125T probably benign Het
Cd180 A G 13: 102,704,923 N159S probably damaging Het
Cd37 T C 7: 45,238,464 probably benign Het
Cdk14 T A 5: 5,093,005 Q242L probably damaging Het
Clcn1 T C 6: 42,307,543 V605A probably damaging Het
Cped1 G A 6: 22,119,470 M309I probably benign Het
Cyp2r1 A T 7: 114,552,736 Y120N probably damaging Het
Ddx3y A T Y: 1,279,491 S124R probably benign Het
Dlec1 A T 9: 119,143,404 probably null Het
Dnah17 T C 11: 118,046,118 E3420G possibly damaging Het
Dnajc13 C T 9: 104,203,414 probably null Het
Dusp23 A T 1: 172,631,686 Y136* probably null Het
Eif4b A G 15: 102,093,136 probably benign Het
F13a1 A G 13: 36,898,143 V529A probably benign Het
Fhl2 A G 1: 43,123,648 Y236H probably damaging Het
Gm826 C T 2: 160,327,106 W94* probably null Het
Gpsm2 C T 3: 108,703,045 R33H probably damaging Het
Hmcn1 T C 1: 150,599,653 probably null Het
Ifit1bl2 T C 19: 34,619,151 D355G probably benign Het
Itga8 A G 2: 12,111,084 V77A probably damaging Het
Kcmf1 C T 6: 72,849,467 R40K probably damaging Het
Kdm7a T C 6: 39,169,048 E315G probably damaging Het
Kmt2b C T 7: 30,569,306 G2666D probably damaging Het
Lrrtm1 A G 6: 77,244,169 N203S probably damaging Het
Mdn1 A G 4: 32,767,969 N5301D probably benign Het
Mest T G 6: 30,742,724 H108Q probably damaging Het
Moxd1 C A 10: 24,281,476 D335E probably damaging Het
Ncf2 A C 1: 152,808,170 N47H probably benign Het
Npc1 A G 18: 12,204,765 probably null Het
Pcid2 A G 8: 13,078,243 V386A probably benign Het
Phactr2 T A 10: 13,245,424 T444S probably benign Het
Plekha7 T C 7: 116,148,324 N710D probably benign Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Pramef20 T C 4: 144,377,184 D124G probably benign Het
Ptprz1 A T 6: 22,961,623 Y111F probably benign Het
Rbbp8 A G 18: 11,732,220 E722G possibly damaging Het
Rimbp3 A G 16: 17,210,326 D538G probably benign Het
Rims1 A G 1: 22,472,820 S551P probably damaging Het
Rrnad1 A G 3: 87,929,860 I36T probably damaging Het
Rsrc1 A G 3: 67,180,831 D166G probably damaging Het
Selenon T C 4: 134,542,843 N350S probably benign Het
Sh3gl2 T A 4: 85,377,565 L168H probably damaging Het
Smc3 T C 19: 53,629,251 Y560H probably benign Het
Syce1 C T 7: 140,779,368 D147N possibly damaging Het
Syt10 A C 15: 89,790,805 V446G probably damaging Het
Taar1 T C 10: 23,920,824 L140P probably benign Het
Tfpi2 C A 6: 3,968,032 C36F probably damaging Het
Thoc5 G A 11: 4,926,237 probably null Het
Tnrc6c T A 11: 117,721,974 N319K probably benign Het
Trhr2 C T 8: 122,358,679 D189N probably damaging Het
Trim42 A T 9: 97,363,421 F442Y probably damaging Het
Ubap2 G A 4: 41,196,033 T949I possibly damaging Het
Ugt1a8 T C 1: 88,088,302 F146L probably benign Het
Vmn2r80 C A 10: 79,194,319 Q660K probably damaging Het
Vstm2b C T 7: 40,929,376 T258I possibly damaging Het
Washc2 T C 6: 116,220,583 L259P possibly damaging Het
Zscan18 A T 7: 12,774,744 probably benign Het
Zzef1 T G 11: 72,866,699 Y1193* probably null Het
Other mutations in Olfr113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr113 APN 17 37574917 missense probably damaging 0.98
IGL01061:Olfr113 APN 17 37574904 missense possibly damaging 0.47
IGL01293:Olfr113 APN 17 37575417 missense probably benign
IGL01370:Olfr113 APN 17 37574521 unclassified probably null
IGL01535:Olfr113 APN 17 37574788 missense possibly damaging 0.90
IGL02134:Olfr113 APN 17 37575358 missense probably benign 0.01
IGL02536:Olfr113 APN 17 37574926 missense probably damaging 1.00
IGL02640:Olfr113 APN 17 37575021 missense possibly damaging 0.73
IGL02652:Olfr113 APN 17 37574945 nonsense probably null
IGL02963:Olfr113 APN 17 37574854 missense probably benign 0.09
R0104:Olfr113 UTSW 17 37574926 missense probably damaging 1.00
R1662:Olfr113 UTSW 17 37575273 missense probably damaging 1.00
R2904:Olfr113 UTSW 17 37574814 missense possibly damaging 0.95
R5129:Olfr113 UTSW 17 37575180 missense probably damaging 1.00
R5197:Olfr113 UTSW 17 37575220 missense probably benign 0.00
R5347:Olfr113 UTSW 17 37574727 missense probably damaging 0.97
R6044:Olfr113 UTSW 17 37574535 missense probably damaging 0.96
R7064:Olfr113 UTSW 17 37574743 missense probably damaging 1.00
X0062:Olfr113 UTSW 17 37574497 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCATACAGCTGTCACAG -3'
(R):5'- GGATTCCTCCTCATGGGATTC -3'

Sequencing Primer
(F):5'- CTGGGACCCATGATGACTTCATAG -3'
(R):5'- GGATTCTCTGACAACCATGAGCTG -3'
Posted On2019-05-13