Incidental Mutation 'R7049:Fastkd2'
ID547466
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene NameFAST kinase domains 2
Synonyms2810421I24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7049 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location63730614-63754655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63731850 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 122 (F122L)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103] [ENSMUST00000114094]
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: F122L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: F122L

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114094
SMART Domains Protein: ENSMUSP00000109728
Gene: ENSMUSG00000025963

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
SCOP:d1b8pa1 131 282 1e-16 SMART
PDB:5MDH|B 131 457 3e-32 PDB
SCOP:d7mdha2 290 454 7e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik T C 6: 116,652,293 L199P probably damaging Het
Abca4 T C 3: 122,147,848 V447A probably benign Het
Adam6b A G 12: 113,490,502 D313G probably damaging Het
Adcy10 G T 1: 165,539,874 C571F probably damaging Het
Anxa1 A G 19: 20,375,271 V313A probably benign Het
Bpifb6 A T 2: 153,908,813 probably null Het
Cacna1c C A 6: 118,601,163 C1713F probably benign Het
Cep135 A G 5: 76,606,738 N354S probably benign Het
Cers2 A G 3: 95,321,654 D200G probably damaging Het
Cpne1 A G 2: 156,078,807 L133P probably damaging Het
Ddhd1 A G 14: 45,602,681 Y16H probably damaging Het
Fastkd5 A T 2: 130,615,511 D386E probably damaging Het
Gm5134 T A 10: 75,992,458 C291S probably damaging Het
Gria2 T C 3: 80,689,327 S811G probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hrnr C A 3: 93,323,154 S233* probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Itgal A T 7: 127,296,401 probably benign Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Mical1 A G 10: 41,482,250 R420G possibly damaging Het
Mllt6 T A 11: 97,673,811 L481Q probably damaging Het
Mtdh T A 15: 34,131,165 N174K probably damaging Het
Nhsl1 A G 10: 18,531,638 M1507V probably damaging Het
Npm3 A T 19: 45,749,555 M1K probably null Het
Olfr380 C T 11: 73,453,604 G203R probably damaging Het
Pold1 A T 7: 44,541,371 W290R possibly damaging Het
Prss52 C T 14: 64,112,572 T216I probably damaging Het
Psme4 T C 11: 30,813,904 probably null Het
Pwwp2a T A 11: 43,706,191 F453I probably damaging Het
Rttn A G 18: 89,064,216 N1422S probably damaging Het
Scaf4 A C 16: 90,260,187 I92R unknown Het
Slc12a1 A G 2: 125,171,257 K345E probably benign Het
Slc22a28 A T 19: 8,071,905 N326K probably benign Het
Smgc A G 15: 91,860,378 E311G possibly damaging Het
Snx7 C T 3: 117,840,031 R90H possibly damaging Het
Tex101 A G 7: 24,668,258 I223T probably benign Het
Tnik A T 3: 28,661,704 K1093* probably null Het
Tnxb T G 17: 34,717,268 probably null Het
Trio T C 15: 27,749,799 N2272S possibly damaging Het
Tubal3 T C 13: 3,932,756 Y179H probably damaging Het
Vmn2r4 C T 3: 64,389,129 G745D probably benign Het
Vps9d1 A T 8: 123,247,143 Y300* probably null Het
Zfp646 T A 7: 127,880,027 C459S possibly damaging Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63737811 missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1579:Fastkd2 UTSW 1 63745887 missense probably null 0.00
R1729:Fastkd2 UTSW 1 63751300 nonsense probably null
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63749896 intron probably benign
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5478:Fastkd2 UTSW 1 63739186 missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63731794 missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63731873 missense possibly damaging 0.79
R7510:Fastkd2 UTSW 1 63737789 missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63731692 missense possibly damaging 0.61
R7972:Fastkd2 UTSW 1 63735460 splice site probably null
Z1177:Fastkd2 UTSW 1 63734836 critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63734837 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGGATTGCAACCATCTG -3'
(R):5'- AAGCGCCTCTTGTCTTCAG -3'

Sequencing Primer
(F):5'- GGGATTGCAACCATCTGTTAGATACC -3'
(R):5'- CAGATATCCTTTTGGCAATTATCCAC -3'
Posted On2019-05-13