Incidental Mutation 'R7049:Mical1'
ID547488
Institutional Source Beutler Lab
Gene Symbol Mical1
Ensembl Gene ENSMUSG00000019823
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 1
SynonymsNical
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7049 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location41476314-41487032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41482250 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 420 (R420G)
Ref Sequence ENSEMBL: ENSMUSP00000097519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019965] [ENSMUST00000019967] [ENSMUST00000099934] [ENSMUST00000119962] [ENSMUST00000126436] [ENSMUST00000151486]
Predicted Effect probably benign
Transcript: ENSMUST00000019965
SMART Domains Protein: ENSMUSP00000019965
Gene: ENSMUSG00000019822

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 11 272 3.9e-24 PFAM
transmembrane domain 322 344 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019967
AA Change: R493G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823
AA Change: R493G

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099934
AA Change: R420G

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823
AA Change: R420G

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119962
AA Change: R493G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823
AA Change: R493G

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126436
AA Change: R493G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823
AA Change: R493G

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151486
Meta Mutation Damage Score 0.1680 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that oxidizes methionine residues on actin, thereby promoting depolymerization of actin filaments. This protein interacts with and regulates signalling by NEDD9/CAS-L (neural precursor cell expressed, developmentally down-regulated 9). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik T C 6: 116,652,293 L199P probably damaging Het
Abca4 T C 3: 122,147,848 V447A probably benign Het
Adam6b A G 12: 113,490,502 D313G probably damaging Het
Adcy10 G T 1: 165,539,874 C571F probably damaging Het
Anxa1 A G 19: 20,375,271 V313A probably benign Het
Bpifb6 A T 2: 153,908,813 probably null Het
Cacna1c C A 6: 118,601,163 C1713F probably benign Het
Cep135 A G 5: 76,606,738 N354S probably benign Het
Cers2 A G 3: 95,321,654 D200G probably damaging Het
Cpne1 A G 2: 156,078,807 L133P probably damaging Het
Ddhd1 A G 14: 45,602,681 Y16H probably damaging Het
Fastkd2 T C 1: 63,731,850 F122L probably benign Het
Fastkd5 A T 2: 130,615,511 D386E probably damaging Het
Gm5134 T A 10: 75,992,458 C291S probably damaging Het
Gria2 T C 3: 80,689,327 S811G probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hrnr C A 3: 93,323,154 S233* probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Itgal A T 7: 127,296,401 probably benign Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Mllt6 T A 11: 97,673,811 L481Q probably damaging Het
Mtdh T A 15: 34,131,165 N174K probably damaging Het
Nhsl1 A G 10: 18,531,638 M1507V probably damaging Het
Npm3 A T 19: 45,749,555 M1K probably null Het
Olfr380 C T 11: 73,453,604 G203R probably damaging Het
Pold1 A T 7: 44,541,371 W290R possibly damaging Het
Prss52 C T 14: 64,112,572 T216I probably damaging Het
Psme4 T C 11: 30,813,904 probably null Het
Pwwp2a T A 11: 43,706,191 F453I probably damaging Het
Rttn A G 18: 89,064,216 N1422S probably damaging Het
Scaf4 A C 16: 90,260,187 I92R unknown Het
Slc12a1 A G 2: 125,171,257 K345E probably benign Het
Slc22a28 A T 19: 8,071,905 N326K probably benign Het
Smgc A G 15: 91,860,378 E311G possibly damaging Het
Snx7 C T 3: 117,840,031 R90H possibly damaging Het
Tex101 A G 7: 24,668,258 I223T probably benign Het
Tnik A T 3: 28,661,704 K1093* probably null Het
Tnxb T G 17: 34,717,268 probably null Het
Trio T C 15: 27,749,799 N2272S possibly damaging Het
Tubal3 T C 13: 3,932,756 Y179H probably damaging Het
Vmn2r4 C T 3: 64,389,129 G745D probably benign Het
Vps9d1 A T 8: 123,247,143 Y300* probably null Het
Zfp646 T A 7: 127,880,027 C459S possibly damaging Het
Other mutations in Mical1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Mical1 APN 10 41479069 critical splice donor site probably null
IGL01594:Mical1 APN 10 41480329 missense probably damaging 1.00
IGL02065:Mical1 APN 10 41484411 missense possibly damaging 0.55
IGL02321:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02323:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02324:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02327:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02416:Mical1 APN 10 41484810 critical splice donor site probably null
IGL02419:Mical1 APN 10 41482277 missense possibly damaging 0.73
IGL03027:Mical1 APN 10 41479505 unclassified probably benign
IGL03087:Mical1 APN 10 41482690 missense probably damaging 1.00
IGL03368:Mical1 APN 10 41479629 missense probably damaging 0.96
IGL03387:Mical1 APN 10 41478199 missense probably damaging 1.00
PIT1430001:Mical1 UTSW 10 41483496 missense possibly damaging 0.55
R0433:Mical1 UTSW 10 41479490 missense probably benign 0.15
R0617:Mical1 UTSW 10 41481315 missense probably damaging 0.97
R0638:Mical1 UTSW 10 41482239 missense probably benign 0.01
R1535:Mical1 UTSW 10 41485211 missense possibly damaging 0.55
R1623:Mical1 UTSW 10 41481393 critical splice donor site probably null
R1712:Mical1 UTSW 10 41480363 missense probably damaging 1.00
R1806:Mical1 UTSW 10 41478214 missense probably damaging 0.96
R1835:Mical1 UTSW 10 41483535 missense probably benign 0.00
R1866:Mical1 UTSW 10 41485470 missense probably benign 0.39
R2134:Mical1 UTSW 10 41482712 missense probably damaging 1.00
R2352:Mical1 UTSW 10 41482233 missense probably benign 0.21
R3740:Mical1 UTSW 10 41479071 missense probably benign 0.01
R4033:Mical1 UTSW 10 41481176 missense probably benign 0.40
R4093:Mical1 UTSW 10 41486937 unclassified probably benign
R4184:Mical1 UTSW 10 41481870 unclassified probably benign
R4194:Mical1 UTSW 10 41481628 missense possibly damaging 0.88
R4659:Mical1 UTSW 10 41486936 unclassified probably benign
R5139:Mical1 UTSW 10 41478415 unclassified probably null
R5173:Mical1 UTSW 10 41484989 missense probably damaging 1.00
R5340:Mical1 UTSW 10 41483431 splice site probably null
R5501:Mical1 UTSW 10 41486079 missense probably benign 0.01
R5560:Mical1 UTSW 10 41478965 missense probably damaging 1.00
R5726:Mical1 UTSW 10 41483696 unclassified probably benign
R5864:Mical1 UTSW 10 41486068 missense possibly damaging 0.88
R5905:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6028:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6047:Mical1 UTSW 10 41481707 critical splice donor site probably null
R6074:Mical1 UTSW 10 41486065 missense probably benign 0.27
R6458:Mical1 UTSW 10 41484735 missense probably benign 0.44
R6879:Mical1 UTSW 10 41484519 missense probably damaging 0.99
R6966:Mical1 UTSW 10 41479754 missense probably damaging 0.98
R7095:Mical1 UTSW 10 41479210 intron probably null
R7156:Mical1 UTSW 10 41485257 critical splice donor site probably null
R7312:Mical1 UTSW 10 41479776 critical splice donor site probably null
X0020:Mical1 UTSW 10 41478996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGACTCTCTACCCTAC -3'
(R):5'- AGCTCAGAGGCTCACAGAAC -3'

Sequencing Primer
(F):5'- GCCCATCTTCCCAGATCAC -3'
(R):5'- CAGGTAGTCTGGGTTTACACC -3'
Posted On2019-05-13