Incidental Mutation 'R7049:Ddhd1'
ID 547496
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene Name DDHD domain containing 1
Synonyms 4921528E07Rik, 9630061G18Rik
MMRRC Submission 045147-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7049 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 45830628-45895600 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45840138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 16 (Y16H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051310
AA Change: Y719H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: Y719H

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087320
AA Change: Y753H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: Y753H

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111828
AA Change: Y719H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: Y719H

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141487
SMART Domains Protein: ENSMUSP00000133358
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
Blast:DDHD 111 149 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149286
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156758
AA Change: Y16H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121837
Gene: ENSMUSG00000037697
AA Change: Y16H

DomainStartEndE-ValueType
DDHD 1 168 3.8e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 121,941,497 (GRCm39) V447A probably benign Het
Adam6b A G 12: 113,454,122 (GRCm39) D313G probably damaging Het
Adcy10 G T 1: 165,367,443 (GRCm39) C571F probably damaging Het
Anxa1 A G 19: 20,352,635 (GRCm39) V313A probably benign Het
Bpifb6 A T 2: 153,750,733 (GRCm39) probably null Het
Cacna1c C A 6: 118,578,124 (GRCm39) C1713F probably benign Het
Cep135 A G 5: 76,754,585 (GRCm39) N354S probably benign Het
Cers2 A G 3: 95,228,965 (GRCm39) D200G probably damaging Het
Cpne1 A G 2: 155,920,727 (GRCm39) L133P probably damaging Het
Depp1 T C 6: 116,629,254 (GRCm39) L199P probably damaging Het
Fastkd2 T C 1: 63,771,009 (GRCm39) F122L probably benign Het
Fastkd5 A T 2: 130,457,431 (GRCm39) D386E probably damaging Het
Gm5134 T A 10: 75,828,292 (GRCm39) C291S probably damaging Het
Gria2 T C 3: 80,596,634 (GRCm39) S811G probably damaging Het
Hcn1 C T 13: 118,111,998 (GRCm39) P654L unknown Het
Hrnr C A 3: 93,230,461 (GRCm39) S233* probably null Het
Hspa5 C T 2: 34,663,204 (GRCm39) P127L probably damaging Het
Itgal A T 7: 126,895,573 (GRCm39) probably benign Het
L3mbtl4 G T 17: 68,768,561 (GRCm39) R223L probably benign Het
Mical1 A G 10: 41,358,246 (GRCm39) R420G possibly damaging Het
Mllt6 T A 11: 97,564,637 (GRCm39) L481Q probably damaging Het
Mtdh T A 15: 34,131,311 (GRCm39) N174K probably damaging Het
Nhsl1 A G 10: 18,407,386 (GRCm39) M1507V probably damaging Het
Npm3 A T 19: 45,737,994 (GRCm39) M1K probably null Het
Or1e21 C T 11: 73,344,430 (GRCm39) G203R probably damaging Het
Pold1 A T 7: 44,190,795 (GRCm39) W290R possibly damaging Het
Prss52 C T 14: 64,350,021 (GRCm39) T216I probably damaging Het
Psme4 T C 11: 30,763,904 (GRCm39) probably null Het
Pwwp2a T A 11: 43,597,018 (GRCm39) F453I probably damaging Het
Rttn A G 18: 89,082,340 (GRCm39) N1422S probably damaging Het
Scaf4 A C 16: 90,057,075 (GRCm39) I92R unknown Het
Slc12a1 A G 2: 125,013,177 (GRCm39) K345E probably benign Het
Slc22a28 A T 19: 8,049,270 (GRCm39) N326K probably benign Het
Smgc A G 15: 91,744,576 (GRCm39) E311G possibly damaging Het
Snx7 C T 3: 117,633,680 (GRCm39) R90H possibly damaging Het
Tex101 A G 7: 24,367,683 (GRCm39) I223T probably benign Het
Tnik A T 3: 28,715,853 (GRCm39) K1093* probably null Het
Tnxb T G 17: 34,936,242 (GRCm39) probably null Het
Trio T C 15: 27,749,885 (GRCm39) N2272S possibly damaging Het
Tubal3 T C 13: 3,982,756 (GRCm39) Y179H probably damaging Het
Vmn2r4 C T 3: 64,296,550 (GRCm39) G745D probably benign Het
Vps9d1 A T 8: 123,973,882 (GRCm39) Y300* probably null Het
Zfp646 T A 7: 127,479,199 (GRCm39) C459S possibly damaging Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45,854,008 (GRCm39) missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45,867,037 (GRCm39) missense probably null 0.98
IGL02176:Ddhd1 APN 14 45,854,057 (GRCm39) missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45,842,663 (GRCm39) unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45,858,240 (GRCm39) missense probably damaging 1.00
PIT4434001:Ddhd1 UTSW 14 45,848,062 (GRCm39) missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45,847,967 (GRCm39) missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45,848,147 (GRCm39) missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45,833,049 (GRCm39) missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45,839,107 (GRCm39) missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45,842,508 (GRCm39) critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45,842,566 (GRCm39) missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45,848,081 (GRCm39) missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45,846,447 (GRCm39) missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45,894,729 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,894,720 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,848,030 (GRCm39) missense probably benign 0.00
R4541:Ddhd1 UTSW 14 45,860,313 (GRCm39) nonsense probably null
R4737:Ddhd1 UTSW 14 45,866,278 (GRCm39) intron probably benign
R5105:Ddhd1 UTSW 14 45,894,864 (GRCm39) missense probably benign 0.00
R5810:Ddhd1 UTSW 14 45,840,164 (GRCm39) missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45,840,125 (GRCm39) missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45,856,971 (GRCm39) splice site probably null
R6218:Ddhd1 UTSW 14 45,851,633 (GRCm39) missense probably damaging 1.00
R6671:Ddhd1 UTSW 14 45,894,689 (GRCm39) frame shift probably null
R6787:Ddhd1 UTSW 14 45,894,976 (GRCm39) missense probably benign 0.01
R7150:Ddhd1 UTSW 14 45,895,263 (GRCm39) missense probably damaging 1.00
R7213:Ddhd1 UTSW 14 45,895,210 (GRCm39) missense probably benign 0.41
R7261:Ddhd1 UTSW 14 45,894,688 (GRCm39) missense probably damaging 1.00
R7522:Ddhd1 UTSW 14 45,895,104 (GRCm39) missense possibly damaging 0.47
R7920:Ddhd1 UTSW 14 45,894,927 (GRCm39) missense probably damaging 0.96
R8736:Ddhd1 UTSW 14 45,836,642 (GRCm39) missense probably benign 0.30
R8880:Ddhd1 UTSW 14 45,846,430 (GRCm39) missense probably benign
R9140:Ddhd1 UTSW 14 45,894,918 (GRCm39) missense probably benign 0.12
R9393:Ddhd1 UTSW 14 45,894,685 (GRCm39) missense probably damaging 1.00
R9398:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9399:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9502:Ddhd1 UTSW 14 45,894,679 (GRCm39) missense possibly damaging 0.75
R9687:Ddhd1 UTSW 14 45,848,190 (GRCm39) missense probably damaging 0.97
Z1177:Ddhd1 UTSW 14 45,895,051 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GAGGATGTCAGAGCATCTGC -3'
(R):5'- TAGGCCTACAGATTAGAACCGTTG -3'

Sequencing Primer
(F):5'- GCTTCAGTCAGCAAAGACGCTAATTC -3'
(R):5'- CCGTTGATTTTGAAACACTACAGC -3'
Posted On 2019-05-13