Incidental Mutation 'R7049:Prss52'
ID547497
Institutional Source Beutler Lab
Gene Symbol Prss52
Ensembl Gene ENSMUSG00000021966
Gene Nameprotease, serine 52
Synonyms1700049K14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7049 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location64104286-64113755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64112572 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 216 (T216I)
Ref Sequence ENSEMBL: ENSMUSP00000022537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022537]
Predicted Effect probably damaging
Transcript: ENSMUST00000022537
AA Change: T216I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022537
Gene: ENSMUSG00000021966
AA Change: T216I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Tryp_SPc 55 282 1.13e-73 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik T C 6: 116,652,293 L199P probably damaging Het
Abca4 T C 3: 122,147,848 V447A probably benign Het
Adam6b A G 12: 113,490,502 D313G probably damaging Het
Adcy10 G T 1: 165,539,874 C571F probably damaging Het
Anxa1 A G 19: 20,375,271 V313A probably benign Het
Bpifb6 A T 2: 153,908,813 probably null Het
Cacna1c C A 6: 118,601,163 C1713F probably benign Het
Cep135 A G 5: 76,606,738 N354S probably benign Het
Cers2 A G 3: 95,321,654 D200G probably damaging Het
Cpne1 A G 2: 156,078,807 L133P probably damaging Het
Ddhd1 A G 14: 45,602,681 Y16H probably damaging Het
Fastkd2 T C 1: 63,731,850 F122L probably benign Het
Fastkd5 A T 2: 130,615,511 D386E probably damaging Het
Gm5134 T A 10: 75,992,458 C291S probably damaging Het
Gria2 T C 3: 80,689,327 S811G probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hrnr C A 3: 93,323,154 S233* probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Itgal A T 7: 127,296,401 probably benign Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Mical1 A G 10: 41,482,250 R420G possibly damaging Het
Mllt6 T A 11: 97,673,811 L481Q probably damaging Het
Mtdh T A 15: 34,131,165 N174K probably damaging Het
Nhsl1 A G 10: 18,531,638 M1507V probably damaging Het
Npm3 A T 19: 45,749,555 M1K probably null Het
Olfr380 C T 11: 73,453,604 G203R probably damaging Het
Pold1 A T 7: 44,541,371 W290R possibly damaging Het
Psme4 T C 11: 30,813,904 probably null Het
Pwwp2a T A 11: 43,706,191 F453I probably damaging Het
Rttn A G 18: 89,064,216 N1422S probably damaging Het
Scaf4 A C 16: 90,260,187 I92R unknown Het
Slc12a1 A G 2: 125,171,257 K345E probably benign Het
Slc22a28 A T 19: 8,071,905 N326K probably benign Het
Smgc A G 15: 91,860,378 E311G possibly damaging Het
Snx7 C T 3: 117,840,031 R90H possibly damaging Het
Tex101 A G 7: 24,668,258 I223T probably benign Het
Tnik A T 3: 28,661,704 K1093* probably null Het
Tnxb T G 17: 34,717,268 probably null Het
Trio T C 15: 27,749,799 N2272S possibly damaging Het
Tubal3 T C 13: 3,932,756 Y179H probably damaging Het
Vmn2r4 C T 3: 64,389,129 G745D probably benign Het
Vps9d1 A T 8: 123,247,143 Y300* probably null Het
Zfp646 T A 7: 127,880,027 C459S possibly damaging Het
Other mutations in Prss52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02898:Prss52 APN 14 64113666 missense possibly damaging 0.84
R0021:Prss52 UTSW 14 64104408 missense probably benign
R0271:Prss52 UTSW 14 64113678 missense probably benign 0.23
R0480:Prss52 UTSW 14 64113644 missense probably damaging 0.99
R1770:Prss52 UTSW 14 64113633 missense probably damaging 0.96
R2216:Prss52 UTSW 14 64113593 missense probably damaging 1.00
R3157:Prss52 UTSW 14 64113543 missense probably damaging 1.00
R3158:Prss52 UTSW 14 64113543 missense probably damaging 1.00
R5613:Prss52 UTSW 14 64109502 missense possibly damaging 0.76
R7529:Prss52 UTSW 14 64109588 missense probably benign 0.02
R8425:Prss52 UTSW 14 64112560 nonsense probably null
RF012:Prss52 UTSW 14 64113473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTCTGGGTGAGCAAAAG -3'
(R):5'- AGGGCTTGTATGATCCTAAGTC -3'

Sequencing Primer
(F):5'- GAGCAAAAGTTCTTTTGTCATTGG -3'
(R):5'- CCTAAGTCATGGTAGGATCATGTAC -3'
Posted On2019-05-13