Incidental Mutation 'R7050:Arhgef38'
ID547517
Institutional Source Beutler Lab
Gene Symbol Arhgef38
Ensembl Gene ENSMUSG00000040969
Gene NameRho guanine nucleotide exchange factor (GEF) 38
SynonymsD630013G24Rik, 9130221D24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7050 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location133112278-133234949 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 133133627 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000054558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054105] [ENSMUST00000147041]
Predicted Effect probably benign
Transcript: ENSMUST00000054105
SMART Domains Protein: ENSMUSP00000054558
Gene: ENSMUSG00000040969

DomainStartEndE-ValueType
SH3 1 60 5.56e-1 SMART
low complexity region 95 106 N/A INTRINSIC
SH3 126 189 8.2e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000147041
AA Change: S552G
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969
AA Change: S552G

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,973,718 A346V possibly damaging Het
Adcy5 A T 16: 35,303,700 M1250L possibly damaging Het
Ascc3 T A 10: 50,840,350 I1944N probably benign Het
Cabin1 G T 10: 75,713,542 P1343Q probably damaging Het
Cbr3 A T 16: 93,690,394 Q155L possibly damaging Het
Cd44 A G 2: 102,814,137 V577A probably damaging Het
Coil C T 11: 88,981,188 T125I possibly damaging Het
Fmo3 T C 1: 162,963,904 N268S probably damaging Het
Fnip2 T C 3: 79,506,270 T248A probably damaging Het
Ggt7 G A 2: 155,506,375 T43I probably benign Het
Gm14025 T C 2: 129,027,971 probably null Het
Gm3250 C A 10: 77,781,980 C188F possibly damaging Het
Iqce G A 5: 140,666,091 S375F possibly damaging Het
Iqgap3 A G 3: 88,098,913 T544A probably damaging Het
Islr A G 9: 58,157,717 L169P probably damaging Het
Kdr G T 5: 75,950,120 T904N probably damaging Het
Mink1 A G 11: 70,612,332 T974A possibly damaging Het
Mms19 A G 19: 41,950,746 probably null Het
Mycl T C 4: 122,997,020 probably null Het
Nab1 A T 1: 52,490,735 M1K probably null Het
Naip6 C T 13: 100,315,499 G202R probably damaging Het
Nbeal2 G A 9: 110,628,720 S2159L probably damaging Het
Neb A T 2: 52,222,876 M4302K possibly damaging Het
Npy1r A G 8: 66,704,540 D204G probably benign Het
Olfr450 T A 6: 42,817,570 V33D possibly damaging Het
Pkdcc T A 17: 83,215,644 I60N possibly damaging Het
Plcxd3 T C 15: 4,516,718 V68A probably damaging Het
Prss36 G T 7: 127,944,765 R145S possibly damaging Het
Pygl C A 12: 70,219,622 G40C probably damaging Het
Rev1 A G 1: 38,054,271 L1064P probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Serpina3k T C 12: 104,341,144 F212L possibly damaging Het
Slc16a4 A T 3: 107,300,832 E219D probably benign Het
Slc6a20b A T 9: 123,598,543 W434R probably damaging Het
Slco1c1 T A 6: 141,547,926 F278Y probably damaging Het
Tbx21 T G 11: 97,114,770 D123A probably benign Het
Trp73 A G 4: 154,081,442 F35L probably damaging Het
Tspan17 T C 13: 54,796,063 V135A probably benign Het
Uba2 G A 7: 34,146,262 Q479* probably null Het
Ubr2 A G 17: 46,961,602 V889A probably benign Het
Unc80 A G 1: 66,550,908 probably null Het
Vmn1r45 A T 6: 89,933,721 I89N probably damaging Het
Vmn2r11 A G 5: 109,054,791 I140T probably benign Het
Yipf2 A T 9: 21,592,178 D24E probably benign Het
Zfp251 T G 15: 76,854,296 Q199P possibly damaging Het
Zfp37 A T 4: 62,191,671 N385K possibly damaging Het
Zfp655 G A 5: 145,244,735 E468K probably benign Het
Other mutations in Arhgef38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Arhgef38 APN 3 133132051 missense probably benign 0.05
IGL00533:Arhgef38 APN 3 133116459 nonsense probably null
IGL03031:Arhgef38 APN 3 133132067 missense possibly damaging 0.90
F5770:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
PIT4362001:Arhgef38 UTSW 3 133160830 missense
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0076:Arhgef38 UTSW 3 133160746 missense possibly damaging 0.52
R0515:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
R0730:Arhgef38 UTSW 3 133137471 missense probably benign 0.25
R0765:Arhgef38 UTSW 3 133116583 missense probably damaging 1.00
R1054:Arhgef38 UTSW 3 133116465 missense probably damaging 1.00
R1261:Arhgef38 UTSW 3 133160863 missense possibly damaging 0.52
R1568:Arhgef38 UTSW 3 133132464 missense probably damaging 0.98
R1580:Arhgef38 UTSW 3 133133704 missense probably benign 0.24
R1716:Arhgef38 UTSW 3 133140837 missense probably benign 0.35
R1875:Arhgef38 UTSW 3 133133740 critical splice acceptor site probably null
R2118:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2119:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2122:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2417:Arhgef38 UTSW 3 133146473 missense probably damaging 1.00
R3832:Arhgef38 UTSW 3 133206925 missense possibly damaging 0.89
R4657:Arhgef38 UTSW 3 133234681 missense probably damaging 1.00
R4666:Arhgef38 UTSW 3 133140772 critical splice donor site probably null
R4732:Arhgef38 UTSW 3 133132269 nonsense probably null
R4733:Arhgef38 UTSW 3 133132269 nonsense probably null
R5059:Arhgef38 UTSW 3 133137414 missense probably damaging 1.00
R5108:Arhgef38 UTSW 3 133137268 missense probably benign 0.14
R5310:Arhgef38 UTSW 3 133116466 missense probably damaging 0.98
R5820:Arhgef38 UTSW 3 133160799 missense probably benign 0.44
R5987:Arhgef38 UTSW 3 133206958 missense possibly damaging 0.67
R6115:Arhgef38 UTSW 3 133132613 intron probably null
R6313:Arhgef38 UTSW 3 133234708 missense possibly damaging 0.80
R6339:Arhgef38 UTSW 3 133133662 missense probably benign 0.35
R6356:Arhgef38 UTSW 3 133140877 missense probably benign 0.01
R6648:Arhgef38 UTSW 3 133132475 missense probably damaging 1.00
R7083:Arhgef38 UTSW 3 133132436 missense unknown
R7561:Arhgef38 UTSW 3 133160728 missense
R7769:Arhgef38 UTSW 3 133149622 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGCTACACCGTATGATTTGTC -3'
(R):5'- AGCAGAGTCAATACCCAGAGTG -3'

Sequencing Primer
(F):5'- CAGCAAATCTGAGTATCCGCTGTG -3'
(R):5'- CCCAGAGTGATTGGTTATCTGAAAAC -3'
Posted On2019-05-13