Mutagenetix > Incidental Mutation

Incidental Mutation 'R7050:Pygl'

547543

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.387) question?

Stock #

R7050 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 70219622 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 40 (G40C)

Ref Sequence

ENSEMBL: ENSMUSP00000125585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably damaging
Transcript: ENSMUST00000071250
AA Change: G131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: G131C

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000161083
AA Change: G40C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: G40C

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,973,718	A346V	possibly damaging	Het
Adcy5	A	T	16: 35,303,700	M1250L	possibly damaging	Het
Arhgef38	T	C	3: 133,133,627		probably benign	Het
Ascc3	T	A	10: 50,840,350	I1944N	probably benign	Het
Cabin1	G	T	10: 75,713,542	P1343Q	probably damaging	Het
Cbr3	A	T	16: 93,690,394	Q155L	possibly damaging	Het
Cd44	A	G	2: 102,814,137	V577A	probably damaging	Het
Coil	C	T	11: 88,981,188	T125I	possibly damaging	Het
Fmo3	T	C	1: 162,963,904	N268S	probably damaging	Het
Fnip2	T	C	3: 79,506,270	T248A	probably damaging	Het
Ggt7	G	A	2: 155,506,375	T43I	probably benign	Het
Gm14025	T	C	2: 129,027,971		probably null	Het
Gm3250	C	A	10: 77,781,980	C188F	possibly damaging	Het
Iqce	G	A	5: 140,666,091	S375F	possibly damaging	Het
Iqgap3	A	G	3: 88,098,913	T544A	probably damaging	Het
Islr	A	G	9: 58,157,717	L169P	probably damaging	Het
Kdr	G	T	5: 75,950,120	T904N	probably damaging	Het
Mink1	A	G	11: 70,612,332	T974A	possibly damaging	Het
Mms19	A	G	19: 41,950,746		probably null	Het
Mycl	T	C	4: 122,997,020		probably null	Het
Nab1	A	T	1: 52,490,735	M1K	probably null	Het
Naip6	C	T	13: 100,315,499	G202R	probably damaging	Het
Nbeal2	G	A	9: 110,628,720	S2159L	probably damaging	Het
Neb	A	T	2: 52,222,876	M4302K	possibly damaging	Het
Npy1r	A	G	8: 66,704,540	D204G	probably benign	Het
Olfr450	T	A	6: 42,817,570	V33D	possibly damaging	Het
Pkdcc	T	A	17: 83,215,644	I60N	possibly damaging	Het
Plcxd3	T	C	15: 4,516,718	V68A	probably damaging	Het
Prss36	G	T	7: 127,944,765	R145S	possibly damaging	Het
Rev1	A	G	1: 38,054,271	L1064P	probably damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Serpina3k	T	C	12: 104,341,144	F212L	possibly damaging	Het
Slc16a4	A	T	3: 107,300,832	E219D	probably benign	Het
Slc6a20b	A	T	9: 123,598,543	W434R	probably damaging	Het
Slco1c1	T	A	6: 141,547,926	F278Y	probably damaging	Het
Tbx21	T	G	11: 97,114,770	D123A	probably benign	Het
Trp73	A	G	4: 154,081,442	F35L	probably damaging	Het
Tspan17	T	C	13: 54,796,063	V135A	probably benign	Het
Uba2	G	A	7: 34,146,262	Q479*	probably null	Het
Ubr2	A	G	17: 46,961,602	V889A	probably benign	Het
Unc80	A	G	1: 66,550,908		probably null	Het
Vmn1r45	A	T	6: 89,933,721	I89N	probably damaging	Het
Vmn2r11	A	G	5: 109,054,791	I140T	probably benign	Het
Yipf2	A	T	9: 21,592,178	D24E	probably benign	Het
Zfp251	T	G	15: 76,854,296	Q199P	possibly damaging	Het
Zfp37	A	T	4: 62,191,671	N385K	possibly damaging	Het
Zfp655	G	A	5: 145,244,735	E468K	probably benign	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TATGTGGCCTGTGATCAGAC -3'
(R):5'- TATGCAATGCCAGAACCGC -3'

Sequencing Primer
(F):5'- TGTGATCAGACCACAGGGC -3'
(R):5'- ATGCCAGAACCGCTTCAGG -3'

Posted On

2019-05-13