Incidental Mutation 'R7050:Adcy5'
ID547549
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R7050 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35303700 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1250 (M1250L)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114913
AA Change: M1250L

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: M1250L

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,973,718 A346V possibly damaging Het
Arhgef38 T C 3: 133,133,627 probably benign Het
Ascc3 T A 10: 50,840,350 I1944N probably benign Het
Cabin1 G T 10: 75,713,542 P1343Q probably damaging Het
Cbr3 A T 16: 93,690,394 Q155L possibly damaging Het
Cd44 A G 2: 102,814,137 V577A probably damaging Het
Coil C T 11: 88,981,188 T125I possibly damaging Het
Fmo3 T C 1: 162,963,904 N268S probably damaging Het
Fnip2 T C 3: 79,506,270 T248A probably damaging Het
Ggt7 G A 2: 155,506,375 T43I probably benign Het
Gm14025 T C 2: 129,027,971 probably null Het
Gm3250 C A 10: 77,781,980 C188F possibly damaging Het
Iqce G A 5: 140,666,091 S375F possibly damaging Het
Iqgap3 A G 3: 88,098,913 T544A probably damaging Het
Islr A G 9: 58,157,717 L169P probably damaging Het
Kdr G T 5: 75,950,120 T904N probably damaging Het
Mink1 A G 11: 70,612,332 T974A possibly damaging Het
Mms19 A G 19: 41,950,746 probably null Het
Mycl T C 4: 122,997,020 probably null Het
Nab1 A T 1: 52,490,735 M1K probably null Het
Naip6 C T 13: 100,315,499 G202R probably damaging Het
Nbeal2 G A 9: 110,628,720 S2159L probably damaging Het
Neb A T 2: 52,222,876 M4302K possibly damaging Het
Npy1r A G 8: 66,704,540 D204G probably benign Het
Olfr450 T A 6: 42,817,570 V33D possibly damaging Het
Pkdcc T A 17: 83,215,644 I60N possibly damaging Het
Plcxd3 T C 15: 4,516,718 V68A probably damaging Het
Prss36 G T 7: 127,944,765 R145S possibly damaging Het
Pygl C A 12: 70,219,622 G40C probably damaging Het
Rev1 A G 1: 38,054,271 L1064P probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Serpina3k T C 12: 104,341,144 F212L possibly damaging Het
Slc16a4 A T 3: 107,300,832 E219D probably benign Het
Slc6a20b A T 9: 123,598,543 W434R probably damaging Het
Slco1c1 T A 6: 141,547,926 F278Y probably damaging Het
Tbx21 T G 11: 97,114,770 D123A probably benign Het
Trp73 A G 4: 154,081,442 F35L probably damaging Het
Tspan17 T C 13: 54,796,063 V135A probably benign Het
Uba2 G A 7: 34,146,262 Q479* probably null Het
Ubr2 A G 17: 46,961,602 V889A probably benign Het
Unc80 A G 1: 66,550,908 probably null Het
Vmn1r45 A T 6: 89,933,721 I89N probably damaging Het
Vmn2r11 A G 5: 109,054,791 I140T probably benign Het
Yipf2 A T 9: 21,592,178 D24E probably benign Het
Zfp251 T G 15: 76,854,296 Q199P possibly damaging Het
Zfp37 A T 4: 62,191,671 N385K possibly damaging Het
Zfp655 G A 5: 145,244,735 E468K probably benign Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATTGTCCCCAAGAGCCAG -3'
(R):5'- TGCTTCTGAGTCAAAGTGGG -3'

Sequencing Primer
(F):5'- TCTCATGTCAGGGCAGCAACAG -3'
(R):5'- TGGGAATTTTACCAGCACAGC -3'
Posted On2019-05-13