Incidental Mutation 'R7051:Smg7'
ID547555
Institutional Source Beutler Lab
Gene Symbol Smg7
Ensembl Gene ENSMUSG00000042772
Gene NameSmg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms9430023P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R7051 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location152836995-152902646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152848850 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 527 (S527P)
Ref Sequence ENSEMBL: ENSMUSP00000107467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043560] [ENSMUST00000073441] [ENSMUST00000111836]
Predicted Effect probably damaging
Transcript: ENSMUST00000043560
AA Change: S535P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041241
Gene: ENSMUSG00000042772
AA Change: S535P

DomainStartEndE-ValueType
Pfam:EST1 63 177 3.4e-30 PFAM
Pfam:EST1_DNA_bind 179 438 3.3e-64 PFAM
low complexity region 457 465 N/A INTRINSIC
low complexity region 615 633 N/A INTRINSIC
low complexity region 682 710 N/A INTRINSIC
low complexity region 711 729 N/A INTRINSIC
low complexity region 874 898 N/A INTRINSIC
low complexity region 906 922 N/A INTRINSIC
low complexity region 931 947 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073441
AA Change: S527P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073144
Gene: ENSMUSG00000042772
AA Change: S527P

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.6e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 653 671 N/A INTRINSIC
low complexity region 720 748 N/A INTRINSIC
low complexity region 749 767 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 996 1022 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111836
AA Change: S527P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107467
Gene: ENSMUSG00000042772
AA Change: S527P

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.7e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 674 702 N/A INTRINSIC
low complexity region 703 721 N/A INTRINSIC
low complexity region 866 890 N/A INTRINSIC
low complexity region 898 914 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
low complexity region 1000 1026 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188937
Meta Mutation Damage Score 0.3763 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is essential for nonsense-mediated mRNA decay (NMD); a process whereby transcripts with premature termination codons are targeted for rapid degradation by a mRNA decay complex. The mRNA decay complex consists, in part, of this protein along with proteins SMG5 and UPF1. The N-terminal domain of this protein is thought to mediate its association with SMG5 or UPF1 while the C-terminal domain interacts with the mRNA decay complex. This protein may therefore couple changes in UPF1 phosphorylation state to the degradation of NMD-candidate transcripts. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Aggf1 T C 13: 95,351,617 K674R possibly damaging Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Clns1a T A 7: 97,712,617 probably null Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Hist1h1e A G 13: 23,622,439 V20A probably benign Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Itga4 T C 2: 79,318,126 V788A possibly damaging Het
Kifap3 G A 1: 163,794,080 R99H probably damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Large2 A T 2: 92,367,022 M411K probably damaging Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr1487 T A 19: 13,619,405 M81K possibly damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Papss1 T C 3: 131,602,050 Y266H probably damaging Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Rptor C T 11: 119,874,186 probably benign Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Tcf20 T C 15: 82,856,078 N391D probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Smg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Smg7 APN 1 152844061 missense possibly damaging 0.68
IGL02320:Smg7 APN 1 152868337 missense possibly damaging 0.49
IGL02336:Smg7 APN 1 152843279 missense probably benign
IGL02680:Smg7 APN 1 152845394 missense probably benign 0.15
IGL03232:Smg7 APN 1 152840156 missense probably damaging 1.00
chill UTSW 1 152840136 splice site probably null
R0322:Smg7 UTSW 1 152849873 critical splice donor site probably null
R0540:Smg7 UTSW 1 152855962 missense probably benign 0.00
R0685:Smg7 UTSW 1 152866648 missense probably damaging 1.00
R0707:Smg7 UTSW 1 152870757 splice site probably null
R1109:Smg7 UTSW 1 152845583 missense probably damaging 1.00
R1118:Smg7 UTSW 1 152866575 splice site probably benign
R1119:Smg7 UTSW 1 152866575 splice site probably benign
R1458:Smg7 UTSW 1 152855843 splice site probably null
R1759:Smg7 UTSW 1 152848846 missense probably benign 0.20
R1846:Smg7 UTSW 1 152848850 missense probably damaging 1.00
R2015:Smg7 UTSW 1 152860508 missense probably damaging 1.00
R2155:Smg7 UTSW 1 152840313 missense possibly damaging 0.49
R2199:Smg7 UTSW 1 152854328 missense probably damaging 1.00
R2234:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R2235:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R3861:Smg7 UTSW 1 152852598 missense probably null 1.00
R4597:Smg7 UTSW 1 152840301 critical splice donor site probably null
R4672:Smg7 UTSW 1 152845413 missense probably damaging 1.00
R4851:Smg7 UTSW 1 152844269 missense probably benign 0.00
R5486:Smg7 UTSW 1 152846176 missense probably damaging 0.97
R5607:Smg7 UTSW 1 152843234 missense probably damaging 0.98
R6131:Smg7 UTSW 1 152845211 critical splice donor site probably null
R6396:Smg7 UTSW 1 152848600 missense probably benign 0.33
R6401:Smg7 UTSW 1 152840136 splice site probably null
R6905:Smg7 UTSW 1 152850006 splice site probably null
R6961:Smg7 UTSW 1 152841583 nonsense probably null
R7124:Smg7 UTSW 1 152878080 missense probably benign 0.01
R7146:Smg7 UTSW 1 152861825 missense probably benign 0.34
R7573:Smg7 UTSW 1 152859489 missense probably damaging 1.00
R7578:Smg7 UTSW 1 152845430 missense probably damaging 1.00
R7621:Smg7 UTSW 1 152841544 missense possibly damaging 0.95
R7956:Smg7 UTSW 1 152844202 missense probably benign 0.02
R8167:Smg7 UTSW 1 152844372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AATACAGCTTACCTGCACTGCC -3'
(R):5'- AGGCTGATTCAGTGTGAAAATG -3'

Sequencing Primer
(F):5'- AAGGTGCATCTCTTGGTCTCAGC -3'
(R):5'- CTGATTCAGTGTGAAAATGAGGTAG -3'
Posted On2019-05-13