Incidental Mutation 'R7051:Kifap3'
ID547557
Institutional Source Beutler Lab
Gene Symbol Kifap3
Ensembl Gene ENSMUSG00000026585
Gene Namekinesin-associated protein 3
SynonymsSmg GDS, KAP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7051 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location163779583-163917109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 163794080 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 99 (R99H)
Ref Sequence ENSEMBL: ENSMUSP00000076830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]
Predicted Effect probably damaging
Transcript: ENSMUST00000027877
AA Change: R99H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585
AA Change: R99H

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077642
AA Change: R99H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585
AA Change: R99H

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Aggf1 T C 13: 95,351,617 K674R possibly damaging Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Clns1a T A 7: 97,712,617 probably null Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Hist1h1e A G 13: 23,622,439 V20A probably benign Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Itga4 T C 2: 79,318,126 V788A possibly damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Large2 A T 2: 92,367,022 M411K probably damaging Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr1487 T A 19: 13,619,405 M81K possibly damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Papss1 T C 3: 131,602,050 Y266H probably damaging Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Rptor C T 11: 119,874,186 probably benign Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Tcf20 T C 15: 82,856,078 N391D probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Kifap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Kifap3 APN 1 163797270 missense probably damaging 1.00
IGL01655:Kifap3 APN 1 163796049 splice site probably benign
IGL02385:Kifap3 APN 1 163865444 nonsense probably null
IGL02517:Kifap3 APN 1 163825871 splice site probably benign
IGL02756:Kifap3 APN 1 163862028 missense probably damaging 0.98
IGL03034:Kifap3 APN 1 163888277 missense probably benign 0.05
IGL03230:Kifap3 APN 1 163825724 missense probably benign 0.02
IGL03270:Kifap3 APN 1 163848733 missense probably benign 0.18
IGL03340:Kifap3 APN 1 163829149 missense possibly damaging 0.94
R0207:Kifap3 UTSW 1 163883386 missense probably benign 0.00
R0333:Kifap3 UTSW 1 163797264 missense probably damaging 1.00
R0426:Kifap3 UTSW 1 163865552 splice site probably benign
R1467:Kifap3 UTSW 1 163829120 splice site probably benign
R1482:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R1547:Kifap3 UTSW 1 163794086 missense probably benign 0.01
R1704:Kifap3 UTSW 1 163829196 missense possibly damaging 0.50
R1724:Kifap3 UTSW 1 163783097 nonsense probably null
R1982:Kifap3 UTSW 1 163862022 nonsense probably null
R2233:Kifap3 UTSW 1 163856065 missense probably benign
R2273:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2274:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2275:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R3420:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3421:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3422:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R4194:Kifap3 UTSW 1 163915825 missense probably benign 0.10
R4260:Kifap3 UTSW 1 163862028 missense probably damaging 0.98
R4464:Kifap3 UTSW 1 163817895 missense probably benign 0.00
R4635:Kifap3 UTSW 1 163814435 missense probably damaging 1.00
R5090:Kifap3 UTSW 1 163856076 missense possibly damaging 0.89
R5426:Kifap3 UTSW 1 163779871 start codon destroyed probably null 0.30
R5868:Kifap3 UTSW 1 163865472 missense probably damaging 1.00
R6107:Kifap3 UTSW 1 163868769 missense possibly damaging 0.50
R6437:Kifap3 UTSW 1 163857526 missense probably damaging 0.99
R6744:Kifap3 UTSW 1 163848670 missense probably benign 0.00
R7143:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R7143:Kifap3 UTSW 1 163856040 missense possibly damaging 0.66
R7216:Kifap3 UTSW 1 163795989 missense probably damaging 0.98
R7467:Kifap3 UTSW 1 163815833 missense probably benign
R7564:Kifap3 UTSW 1 163915768 missense probably damaging 1.00
R7939:Kifap3 UTSW 1 163815858 nonsense probably null
R8108:Kifap3 UTSW 1 163797362 missense probably damaging 0.99
U24488:Kifap3 UTSW 1 163783035 missense possibly damaging 0.64
Z1177:Kifap3 UTSW 1 163862062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCTGTAATGTCTGAACTGGC -3'
(R):5'- CCTCCAGTGTAGGAAACAAATTC -3'

Sequencing Primer
(F):5'- AACTGGCAATTCGCATGTGC -3'
(R):5'- TGTCCTGACACTGGTAAGAACTC -3'
Posted On2019-05-13