Incidental Mutation 'R7051:Large2'
ID547560
Institutional Source Beutler Lab
Gene Symbol Large2
Ensembl Gene ENSMUSG00000040434
Gene NameLARGE xylosyl- and glucuronyltransferase 2
Synonyms5730485C17Rik, Gyltl1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7051 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location92365046-92374869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92367022 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 411 (M411K)
Ref Sequence ENSEMBL: ENSMUSP00000064128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044036] [ENSMUST00000068586] [ENSMUST00000068702] [ENSMUST00000090582] [ENSMUST00000090586] [ENSMUST00000111284] [ENSMUST00000111290] [ENSMUST00000111297] [ENSMUST00000148352] [ENSMUST00000176289] [ENSMUST00000176339] [ENSMUST00000176774] [ENSMUST00000176810]
Predicted Effect probably benign
Transcript: ENSMUST00000044036
SMART Domains Protein: ENSMUSP00000038497
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068586
AA Change: M411K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064128
Gene: ENSMUSG00000040434
AA Change: M411K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 316 4.6e-22 PFAM
low complexity region 392 401 N/A INTRINSIC
Pfam:Glyco_transf_49 402 469 2.2e-11 PFAM
Pfam:Glyco_transf_49 466 673 1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068702
SMART Domains Protein: ENSMUSP00000070649
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090582
AA Change: M376K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088070
Gene: ENSMUSG00000040434
AA Change: M376K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 218 7.2e-9 PFAM
Pfam:Glyco_transf_8 188 281 2.3e-8 PFAM
low complexity region 357 366 N/A INTRINSIC
Pfam:Glyco_transf_49 367 434 2.1e-11 PFAM
Pfam:Glyco_transf_49 431 638 9.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090586
SMART Domains Protein: ENSMUSP00000088074
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111284
AA Change: M436K

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106915
Gene: ENSMUSG00000040434
AA Change: M436K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 97 341 8.9e-22 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 494 6.5e-11 PFAM
Pfam:Glyco_transf_49 491 698 3.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111290
SMART Domains Protein: ENSMUSP00000106921
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 405 417 4.28e-1 SMART
low complexity region 424 436 N/A INTRINSIC
PHD 470 513 3.12e-15 SMART
RING 471 512 1.85e-1 SMART
coiled coil region 537 582 N/A INTRINSIC
low complexity region 630 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111297
SMART Domains Protein: ENSMUSP00000106928
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
PHD 422 465 3.12e-15 SMART
RING 423 464 1.85e-1 SMART
coiled coil region 489 534 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148352
SMART Domains Protein: ENSMUSP00000135451
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176289
SMART Domains Protein: ENSMUSP00000135118
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176339
SMART Domains Protein: ENSMUSP00000135619
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176774
AA Change: M412K

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135400
Gene: ENSMUSG00000040434
AA Change: M412K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 71 317 3.9e-22 PFAM
low complexity region 393 402 N/A INTRINSIC
Pfam:Glyco_transf_49 403 470 1.6e-11 PFAM
Pfam:Glyco_transf_49 467 674 7.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176810
AA Change: M436K

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135024
Gene: ENSMUSG00000040434
AA Change: M436K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 101 342 4.2e-20 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 493 1.3e-13 PFAM
Pfam:Glyco_transf_49 489 698 2.8e-46 PFAM
Meta Mutation Damage Score 0.3187 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (80/84)
MGI Phenotype PHENOTYPE: Null mutant mice are healthy and are indistinguishable from control littermates with respect to body weight and life span when aged up to one year. No increased spontaneous tumor load was observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Aggf1 T C 13: 95,351,617 K674R possibly damaging Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Clns1a T A 7: 97,712,617 probably null Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Hist1h1e A G 13: 23,622,439 V20A probably benign Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Itga4 T C 2: 79,318,126 V788A possibly damaging Het
Kifap3 G A 1: 163,794,080 R99H probably damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr1487 T A 19: 13,619,405 M81K possibly damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Papss1 T C 3: 131,602,050 Y266H probably damaging Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Rptor C T 11: 119,874,186 probably benign Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Tcf20 T C 15: 82,856,078 N391D probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Large2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Large2 APN 2 92366339 missense probably damaging 1.00
IGL01152:Large2 APN 2 92370639 missense probably damaging 1.00
IGL01377:Large2 APN 2 92369331 missense probably damaging 1.00
IGL01764:Large2 APN 2 92367186 splice site probably benign
IGL02016:Large2 APN 2 92369543 missense possibly damaging 0.82
IGL02396:Large2 APN 2 92366323 nonsense probably null
IGL02996:Large2 APN 2 92365928 missense possibly damaging 0.88
IGL03011:Large2 APN 2 92367582 missense probably damaging 1.00
egged UTSW 2 92370508 intron probably benign
P0041:Large2 UTSW 2 92367254 splice site probably benign
R1915:Large2 UTSW 2 92365825 splice site probably benign
R4193:Large2 UTSW 2 92365359 missense probably damaging 1.00
R4239:Large2 UTSW 2 92366605 splice site probably benign
R4580:Large2 UTSW 2 92370612 missense possibly damaging 0.66
R4679:Large2 UTSW 2 92367558 missense probably benign 0.31
R4857:Large2 UTSW 2 92366634 intron probably benign
R4918:Large2 UTSW 2 92366107 intron probably benign
R5050:Large2 UTSW 2 92367779 missense probably benign 0.05
R5237:Large2 UTSW 2 92367142 missense probably benign 0.16
R5264:Large2 UTSW 2 92374743 unclassified probably benign
R5508:Large2 UTSW 2 92369903 missense possibly damaging 0.80
R5999:Large2 UTSW 2 92366058 missense probably benign 0.01
R6077:Large2 UTSW 2 92366570 missense probably benign 0.00
R6167:Large2 UTSW 2 92367088 missense probably benign 0.44
R6218:Large2 UTSW 2 92370636 missense probably damaging 0.99
R6225:Large2 UTSW 2 92366480 missense probably damaging 1.00
R6301:Large2 UTSW 2 92369516 missense probably damaging 1.00
R6376:Large2 UTSW 2 92370508 intron probably benign
R6485:Large2 UTSW 2 92366028 missense probably benign
R6727:Large2 UTSW 2 92370870 utr 5 prime probably benign
R6942:Large2 UTSW 2 92370822 missense probably damaging 0.99
R7318:Large2 UTSW 2 92366028 missense probably benign
R7581:Large2 UTSW 2 92370193 missense probably damaging 1.00
R7640:Large2 UTSW 2 92374705 start codon destroyed probably null
Z1176:Large2 UTSW 2 92370198 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTAGCTGCTGAAAGGCTCC -3'
(R):5'- AACCCTGCTCAGTTGCAAC -3'

Sequencing Primer
(F):5'- GGGTGCATCTACATTTGACAACCG -3'
(R):5'- TGCTCAGTTGCAACAGGCC -3'
Posted On2019-05-13