Incidental Mutation 'R7051:Papss1'
ID547570
Institutional Source Beutler Lab
Gene Symbol Papss1
Ensembl Gene ENSMUSG00000028032
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 1
SynonymsAsapk, SK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R7051 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location131564768-131643671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131602050 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 266 (Y266H)
Ref Sequence ENSEMBL: ENSMUSP00000142616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029666] [ENSMUST00000197402] [ENSMUST00000199878] [ENSMUST00000200527]
Predicted Effect probably damaging
Transcript: ENSMUST00000029666
AA Change: Y287H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029666
Gene: ENSMUSG00000028032
AA Change: Y287H

DomainStartEndE-ValueType
Pfam:APS_kinase 51 209 5.6e-78 PFAM
Pfam:AAA_17 54 184 1.7e-7 PFAM
Pfam:AAA_33 55 182 4.4e-9 PFAM
Pfam:PUA_2 225 386 3.3e-51 PFAM
Pfam:ATP-sulfurylase 394 617 7.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197402
Predicted Effect probably damaging
Transcript: ENSMUST00000199878
AA Change: Y266H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142533
Gene: ENSMUSG00000028032
AA Change: Y266H

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200527
AA Change: Y266H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142616
Gene: ENSMUSG00000028032
AA Change: Y266H

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS) is the sulfate donor cosubstrate for all sulfotransferase (SULT) enzymes (Xu et al., 2000 [PubMed 10679223]). SULTs catalyze the sulfate conjugation of many endogenous and exogenous compounds, including drugs and other xenobiotics. In humans, PAPS is synthesized from adenosine 5-prime triphosphate (ATP) and inorganic sulfate by 2 isoforms, PAPSS1 and PAPSS2 (MIM 603005).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Aggf1 T C 13: 95,351,617 K674R possibly damaging Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Clns1a T A 7: 97,712,617 probably null Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Hist1h1e A G 13: 23,622,439 V20A probably benign Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Itga4 T C 2: 79,318,126 V788A possibly damaging Het
Kifap3 G A 1: 163,794,080 R99H probably damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Large2 A T 2: 92,367,022 M411K probably damaging Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr1487 T A 19: 13,619,405 M81K possibly damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Rptor C T 11: 119,874,186 probably benign Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Tcf20 T C 15: 82,856,078 N391D probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Papss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Papss1 APN 3 131599949 missense probably benign 0.00
IGL01642:Papss1 APN 3 131583235 splice site probably benign
IGL02249:Papss1 APN 3 131602011 missense probably damaging 1.00
IGL02832:Papss1 APN 3 131582519 missense probably damaging 1.00
IGL03008:Papss1 APN 3 131585099 missense possibly damaging 0.55
IGL03180:Papss1 APN 3 131607382 missense probably damaging 1.00
IGL03343:Papss1 APN 3 131583189 missense probably benign 0.27
IGL03384:Papss1 APN 3 131579352 missense probably damaging 0.96
R0549:Papss1 UTSW 3 131619213 missense possibly damaging 0.87
R0685:Papss1 UTSW 3 131583093 missense possibly damaging 0.61
R0800:Papss1 UTSW 3 131599854 splice site probably benign
R1225:Papss1 UTSW 3 131579301 splice site probably benign
R1458:Papss1 UTSW 3 131605854 missense probably damaging 1.00
R1718:Papss1 UTSW 3 131619185 missense probably damaging 1.00
R1728:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1784:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1862:Papss1 UTSW 3 131583184 missense possibly damaging 0.93
R1937:Papss1 UTSW 3 131599871 missense probably benign 0.38
R2349:Papss1 UTSW 3 131599866 missense probably benign
R3859:Papss1 UTSW 3 131607335 missense probably benign 0.30
R4698:Papss1 UTSW 3 131607331 missense probably damaging 0.97
R4741:Papss1 UTSW 3 131619099 missense probably damaging 1.00
R5333:Papss1 UTSW 3 131643044 missense probably damaging 1.00
R5642:Papss1 UTSW 3 131631804 nonsense probably null
R6658:Papss1 UTSW 3 131605935 missense probably benign
R6932:Papss1 UTSW 3 131599971 missense probably damaging 1.00
R7199:Papss1 UTSW 3 131585138 missense probably benign 0.01
R7201:Papss1 UTSW 3 131599926 missense probably damaging 1.00
R7276:Papss1 UTSW 3 131619234 missense probably benign 0.11
R7575:Papss1 UTSW 3 131643096 missense probably damaging 0.99
R7627:Papss1 UTSW 3 131585112 missense probably benign 0.01
R8325:Papss1 UTSW 3 131582611 missense probably benign
R8380:Papss1 UTSW 3 131631695 missense probably damaging 1.00
Z1088:Papss1 UTSW 3 131642967 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACAACCATCACTGCTATGTCTG -3'
(R):5'- AACGAGATCCCACGGTTCAC -3'

Sequencing Primer
(F):5'- GTCCCCATTACTTTCCAGCTGAAATG -3'
(R):5'- GAGATCCCACGGTTCACTCAAAG -3'
Posted On2019-05-13