Incidental Mutation 'R7051:Vps13d'
ID547572
Institutional Source Beutler Lab
Gene Symbol Vps13d
Ensembl Gene ENSMUSG00000020220
Gene Namevacuolar protein sorting 13D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7051 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location144972622-145195005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 145163344 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 597 (A597S)
Ref Sequence ENSEMBL: ENSMUSP00000020441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579]
Predicted Effect probably benign
Transcript: ENSMUST00000020441
AA Change: A597S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220
AA Change: A597S

DomainStartEndE-ValueType
Pfam:Chorein_N 2 118 1.8e-37 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
coiled coil region 665 685 N/A INTRINSIC
low complexity region 765 781 N/A INTRINSIC
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2866 2884 N/A INTRINSIC
low complexity region 2973 2983 N/A INTRINSIC
Pfam:DUF1162 3246 3530 1.1e-110 PFAM
low complexity region 3797 3810 N/A INTRINSIC
low complexity region 3913 3921 N/A INTRINSIC
low complexity region 4119 4132 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220
AA Change: A603S

DomainStartEndE-ValueType
Pfam:Chorein_N 2 116 3.5e-35 PFAM
Pfam:VPS13 131 353 9.6e-57 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
Pfam:VPS13_mid_rpt 608 896 4.3e-35 PFAM
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2891 2909 N/A INTRINSIC
low complexity region 2998 3008 N/A INTRINSIC
Pfam:SHR-BD 3271 3555 4.2e-86 PFAM
low complexity region 3822 3835 N/A INTRINSIC
low complexity region 3938 3946 N/A INTRINSIC
Pfam:VPS13_C 3978 4126 4.8e-24 PFAM
low complexity region 4144 4157 N/A INTRINSIC
Meta Mutation Damage Score 0.0690 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Aggf1 T C 13: 95,351,617 K674R possibly damaging Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Clns1a T A 7: 97,712,617 probably null Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Hist1h1e A G 13: 23,622,439 V20A probably benign Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Itga4 T C 2: 79,318,126 V788A possibly damaging Het
Kifap3 G A 1: 163,794,080 R99H probably damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Large2 A T 2: 92,367,022 M411K probably damaging Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr1487 T A 19: 13,619,405 M81K possibly damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Papss1 T C 3: 131,602,050 Y266H probably damaging Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Rptor C T 11: 119,874,186 probably benign Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Tcf20 T C 15: 82,856,078 N391D probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Vps13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vps13d APN 4 145168540 missense probably damaging 0.98
IGL00484:Vps13d APN 4 145126575 missense probably benign 0.04
IGL00591:Vps13d APN 4 145190559 missense possibly damaging 0.95
IGL00816:Vps13d APN 4 145155994 missense probably benign 0.00
IGL00835:Vps13d APN 4 145160652 missense probably damaging 0.97
IGL00847:Vps13d APN 4 145085408 missense probably benign 0.26
IGL01084:Vps13d APN 4 145154955 missense probably benign 0.00
IGL01116:Vps13d APN 4 144972750 unclassified probably benign
IGL01150:Vps13d APN 4 145149275 missense probably benign
IGL01329:Vps13d APN 4 145156206 missense possibly damaging 0.69
IGL01338:Vps13d APN 4 145088322 missense probably damaging 1.00
IGL01583:Vps13d APN 4 145045088 missense probably damaging 1.00
IGL01598:Vps13d APN 4 145016901 missense probably benign 0.21
IGL01620:Vps13d APN 4 145094867 missense possibly damaging 0.70
IGL01636:Vps13d APN 4 145075048 missense probably damaging 1.00
IGL01723:Vps13d APN 4 145173145 missense possibly damaging 0.84
IGL01895:Vps13d APN 4 145156266 missense possibly damaging 0.57
IGL01981:Vps13d APN 4 145086747 missense probably damaging 0.99
IGL02192:Vps13d APN 4 145148858 missense probably benign 0.02
IGL02197:Vps13d APN 4 145128309 missense probably benign 0.01
IGL02209:Vps13d APN 4 145156101 missense probably damaging 0.97
IGL02219:Vps13d APN 4 145168146 missense probably benign 0.00
IGL02377:Vps13d APN 4 145156364 missense probably damaging 1.00
IGL02404:Vps13d APN 4 145148735 missense probably damaging 1.00
IGL02552:Vps13d APN 4 145173137 missense possibly damaging 0.46
IGL02651:Vps13d APN 4 145164559 missense probably benign 0.02
IGL02708:Vps13d APN 4 145128280 missense probably benign 0.12
IGL02811:Vps13d APN 4 145131765 missense possibly damaging 0.55
IGL02821:Vps13d APN 4 145148762 missense probably damaging 0.98
IGL02838:Vps13d APN 4 145075025 missense probably benign 0.31
IGL02968:Vps13d APN 4 145122498 missense probably benign 0.32
IGL03176:Vps13d APN 4 145074963 missense probably benign 0.16
IGL03352:Vps13d APN 4 145167502 missense possibly damaging 0.49
IGL03374:Vps13d APN 4 145108575 missense possibly damaging 0.70
IGL03375:Vps13d APN 4 145091947 missense probably damaging 1.00
IGL03383:Vps13d APN 4 145168319 critical splice acceptor site probably null
IGL03411:Vps13d APN 4 145149324 missense probably damaging 1.00
PIT4283001:Vps13d UTSW 4 145108588 missense
PIT4434001:Vps13d UTSW 4 145155247 missense
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0076:Vps13d UTSW 4 145164694 splice site probably benign
R0211:Vps13d UTSW 4 145114778 missense probably benign 0.08
R0219:Vps13d UTSW 4 145105909 missense probably benign 0.01
R0284:Vps13d UTSW 4 145144802 missense probably benign 0.01
R0345:Vps13d UTSW 4 145117625 missense possibly damaging 0.81
R0400:Vps13d UTSW 4 145065827 missense probably benign 0.00
R0417:Vps13d UTSW 4 144976560 missense probably benign 0.19
R0538:Vps13d UTSW 4 145045095 missense probably damaging 1.00
R0560:Vps13d UTSW 4 145054190 missense probably damaging 1.00
R0627:Vps13d UTSW 4 145087184 missense probably damaging 1.00
R0707:Vps13d UTSW 4 145155932 missense probably damaging 1.00
R0782:Vps13d UTSW 4 145126625 splice site probably benign
R0925:Vps13d UTSW 4 145156551 missense probably damaging 1.00
R0993:Vps13d UTSW 4 145117692 nonsense probably null
R1135:Vps13d UTSW 4 145155589 missense probably benign 0.01
R1165:Vps13d UTSW 4 145126471 missense probably benign
R1263:Vps13d UTSW 4 145170348 missense probably benign 0.01
R1397:Vps13d UTSW 4 145141334 missense probably damaging 1.00
R1398:Vps13d UTSW 4 145099983 missense probably null
R1521:Vps13d UTSW 4 145105861 missense probably benign 0.00
R1522:Vps13d UTSW 4 145098172 splice site probably null
R1725:Vps13d UTSW 4 145143260 missense possibly damaging 0.90
R1759:Vps13d UTSW 4 145155857 missense probably benign
R1826:Vps13d UTSW 4 145155003 missense probably damaging 0.96
R1900:Vps13d UTSW 4 145126606 missense probably benign 0.23
R1943:Vps13d UTSW 4 145155857 missense probably benign
R1955:Vps13d UTSW 4 145156143 missense probably damaging 1.00
R2008:Vps13d UTSW 4 145155243 missense probably benign 0.00
R2013:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2014:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2038:Vps13d UTSW 4 145181115 critical splice donor site probably null
R2108:Vps13d UTSW 4 145075047 missense probably damaging 0.99
R2130:Vps13d UTSW 4 145156101 missense probably benign 0.17
R2134:Vps13d UTSW 4 145148339 missense probably benign 0.00
R2168:Vps13d UTSW 4 145087323 splice site probably benign
R2220:Vps13d UTSW 4 145178320 missense probably damaging 1.00
R2240:Vps13d UTSW 4 145110895 missense possibly damaging 0.70
R2332:Vps13d UTSW 4 145148686 missense probably benign
R2357:Vps13d UTSW 4 145074977 frame shift probably null
R2365:Vps13d UTSW 4 145087324 splice site probably benign
R2571:Vps13d UTSW 4 145149136 missense probably benign 0.20
R3149:Vps13d UTSW 4 145126577 missense possibly damaging 0.70
R3150:Vps13d UTSW 4 145086790 missense probably damaging 0.98
R3547:Vps13d UTSW 4 145074975 missense probably damaging 0.99
R3716:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3718:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3725:Vps13d UTSW 4 145115648 splice site probably benign
R3794:Vps13d UTSW 4 145085437 splice site probably benign
R3875:Vps13d UTSW 4 145190544 missense probably damaging 1.00
R3948:Vps13d UTSW 4 145141340 missense probably damaging 1.00
R3953:Vps13d UTSW 4 145148880 missense probably damaging 1.00
R4021:Vps13d UTSW 4 145075061 missense possibly damaging 0.90
R4323:Vps13d UTSW 4 145152778 missense probably benign 0.28
R4346:Vps13d UTSW 4 145072529 intron probably benign
R4509:Vps13d UTSW 4 145062602 missense probably damaging 1.00
R4613:Vps13d UTSW 4 145131655 missense possibly damaging 0.95
R4657:Vps13d UTSW 4 145074842 missense probably damaging 1.00
R4680:Vps13d UTSW 4 145108510 missense possibly damaging 0.94
R4688:Vps13d UTSW 4 145178212 missense probably benign
R4797:Vps13d UTSW 4 145054155 missense probably damaging 1.00
R4798:Vps13d UTSW 4 145178056 missense probably damaging 0.98
R4817:Vps13d UTSW 4 145069165 missense probably damaging 1.00
R4839:Vps13d UTSW 4 145085430 missense possibly damaging 0.95
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4869:Vps13d UTSW 4 145128042 missense probably damaging 1.00
R4904:Vps13d UTSW 4 145155445 missense probably damaging 1.00
R4912:Vps13d UTSW 4 145155857 missense probably benign
R4916:Vps13d UTSW 4 144983393 missense probably damaging 1.00
R4976:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5029:Vps13d UTSW 4 145156282 missense probably benign 0.02
R5049:Vps13d UTSW 4 145086766 missense probably damaging 1.00
R5077:Vps13d UTSW 4 145088241 missense probably damaging 0.98
R5119:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5227:Vps13d UTSW 4 145181207 splice site probably null
R5291:Vps13d UTSW 4 145062569 missense probably damaging 0.99
R5344:Vps13d UTSW 4 145178334 missense probably damaging 0.98
R5348:Vps13d UTSW 4 145065889 missense probably damaging 0.99
R5478:Vps13d UTSW 4 145167550 missense probably damaging 0.99
R5632:Vps13d UTSW 4 145074882 missense probably damaging 0.99
R5642:Vps13d UTSW 4 145170302 missense possibly damaging 0.66
R5712:Vps13d UTSW 4 145087173 missense probably benign 0.07
R5747:Vps13d UTSW 4 145168283 missense probably benign 0.00
R5752:Vps13d UTSW 4 145148970 missense probably benign 0.06
R5804:Vps13d UTSW 4 145100070 missense probably benign 0.03
R5917:Vps13d UTSW 4 145100010 missense probably damaging 0.96
R5932:Vps13d UTSW 4 145045041 missense possibly damaging 0.71
R5940:Vps13d UTSW 4 145074975 missense probably benign 0.09
R5978:Vps13d UTSW 4 145122611 missense probably benign
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6143:Vps13d UTSW 4 145148565 missense possibly damaging 0.95
R6174:Vps13d UTSW 4 144975193 nonsense probably null
R6191:Vps13d UTSW 4 145149348 missense probably damaging 1.00
R6198:Vps13d UTSW 4 145148990 missense probably benign 0.28
R6374:Vps13d UTSW 4 145122681 missense probably damaging 1.00
R6379:Vps13d UTSW 4 145088258 missense probably benign
R6388:Vps13d UTSW 4 145155574 missense probably benign 0.06
R6418:Vps13d UTSW 4 145092280 missense probably damaging 0.98
R6466:Vps13d UTSW 4 145057495 missense possibly damaging 0.47
R6602:Vps13d UTSW 4 145103664 intron probably benign
R6604:Vps13d UTSW 4 145181124 missense probably damaging 1.00
R7052:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7103:Vps13d UTSW 4 145115492 missense
R7231:Vps13d UTSW 4 145057462 missense
R7246:Vps13d UTSW 4 145156050 missense
R7339:Vps13d UTSW 4 145121368 missense
R7409:Vps13d UTSW 4 145141254 missense
R7419:Vps13d UTSW 4 145115503 missense
R7424:Vps13d UTSW 4 145148747 missense
R7439:Vps13d UTSW 4 145105856 missense
R7440:Vps13d UTSW 4 145128411 missense
R7528:Vps13d UTSW 4 145091922 missense
R7547:Vps13d UTSW 4 145057538 missense
R7558:Vps13d UTSW 4 145154580 missense
R7729:Vps13d UTSW 4 145075052 missense
R7789:Vps13d UTSW 4 145100065 missense
R7813:Vps13d UTSW 4 145178063 nonsense probably null
R7834:Vps13d UTSW 4 145108573 missense
R7840:Vps13d UTSW 4 145103676 missense
R7880:Vps13d UTSW 4 145181114 critical splice donor site probably null
R7912:Vps13d UTSW 4 145173127 missense
R7917:Vps13d UTSW 4 145108573 missense
R7923:Vps13d UTSW 4 145103676 missense
R7963:Vps13d UTSW 4 145181114 critical splice donor site probably null
R7993:Vps13d UTSW 4 145173127 missense
R8021:Vps13d UTSW 4 145148675 missense
R8048:Vps13d UTSW 4 145155567 missense
R8057:Vps13d UTSW 4 144975183 missense
R8063:Vps13d UTSW 4 145114757 missense
R8131:Vps13d UTSW 4 145156137 missense
X0021:Vps13d UTSW 4 145155025 missense probably damaging 0.99
Z1176:Vps13d UTSW 4 145107067 missense
Z1177:Vps13d UTSW 4 145154908 missense
Z1177:Vps13d UTSW 4 145178296 missense
Predicted Primers PCR Primer
(F):5'- TGCATCAGAAATGACCCAAGAG -3'
(R):5'- CTTGCACTGCATTATGGGAAC -3'

Sequencing Primer
(F):5'- CAAAGGTAACATAGGATCAAACAAAC -3'
(R):5'- CAGTAGTCTAGCTGTCAAGATTCCTG -3'
Posted On2019-05-13