Mutagenetix > Incidental Mutations

Incidental Mutation 'R7051:Sin3a'

547597

Institutional Source

Beutler Lab

Gene Symbol

Sin3a

Ensembl Gene

ENSMUSG00000042557

Gene Name

transcriptional regulator, SIN3A (yeast)

Synonyms

Sin3, mSin3A

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7051 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57072040-57128366 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 57103934 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 492 (N492Y)

Ref Sequence

ENSEMBL: ENSMUSP00000126601 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049169
AA Change: N492Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: N492Y

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167715
AA Change: N492Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: N492Y

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168177
AA Change: N492Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: N492Y

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	142	186	5.3e-22	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	323	380	9.6e-22	PFAM
Pfam:PAH	479	523	8.1e-11	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
Pfam:Sin3a_C	887	1190	1.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168502
AA Change: N492Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: N492Y

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1138	1154	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168678
AA Change: N492Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: N492Y

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

95% (80/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5930422O12Rik	C	T	8: 33,429,173	S7L	unknown	Het
Aggf1	T	C	13: 95,351,617	K674R	possibly damaging	Het
Ampd1	T	C	3: 103,090,073	F264L	probably damaging	Het
Ankle1	A	T	8: 71,407,743	S302C	probably damaging	Het
Ankrd17	G	A	5: 90,366,451		probably benign	Het
Arhgap18	T	A	10: 26,849,921	N47K	possibly damaging	Het
Atp5f1	T	C	3: 105,943,767	N205D	probably benign	Het
Atp8b3	C	T	10: 80,520,024	E1285K	probably benign	Het
Atp8b3	C	A	10: 80,529,718	V401L	probably damaging	Het
Cacna1a	G	A	8: 84,629,915	R1929Q	possibly damaging	Het
Cadm2	C	T	16: 66,882,879	S22N	possibly damaging	Het
Ccdc177	C	T	12: 80,759,153	V116M	probably damaging	Het
Cdkl2	A	T	5: 92,033,225	I185N	probably damaging	Het
Cfhr2	T	A	1: 139,810,978	I282L	probably benign	Het
Clns1a	T	A	7: 97,712,617		probably null	Het
Commd2	A	T	3: 57,646,686	I198N	probably damaging	Het
Creb3l2	C	T	6: 37,336,265	V365I	possibly damaging	Het
Dcaf6	A	T	1: 165,424,317	N79K	possibly damaging	Het
Dlg5	T	C	14: 24,146,195	N1622D	possibly damaging	Het
Dock7	C	T	4: 98,946,732	R1802H	probably damaging	Het
Dpy19l2	T	C	9: 24,584,493	K643R	probably benign	Het
Dscam	G	A	16: 96,819,786	T574M	probably benign	Het
Fam209	A	G	2: 172,474,049	T115A	probably damaging	Het
Fastkd5	C	T	2: 130,614,417	C751Y	probably damaging	Het
Fat3	C	A	9: 16,377,827	L133F	probably damaging	Het
Frmd6	T	C	12: 70,897,396	V516A	possibly damaging	Het
Fry	G	A	5: 150,395,169	D955N	possibly damaging	Het
Fuk	A	T	8: 110,890,339	I393N	probably damaging	Het
Gm281	A	G	14: 13,828,486	V758A		Het
Gm340	A	G	19: 41,585,752	D982G	probably benign	Het
Gm7298	T	C	6: 121,775,034		probably null	Het
Golga7b	T	A	19: 42,268,460	*168R	probably null	Het
Golim4	T	A	3: 75,893,002	Q395L	probably benign	Het
Gxylt2	T	A	6: 100,804,576	L404*	probably null	Het
Hist1h1e	A	G	13: 23,622,439	V20A	probably benign	Het
Ighmbp2	G	T	19: 3,261,462	S984R	probably damaging	Het
Irf8	C	T	8: 120,739,842	R9W	probably damaging	Het
Itga4	T	C	2: 79,318,126	V788A	possibly damaging	Het
Kifap3	G	A	1: 163,794,080	R99H	probably damaging	Het
Kiss1r	T	C	10: 79,918,854	S61P	probably damaging	Het
Krtap6-1	A	T	16: 89,031,718	M1L	unknown	Het
Large2	A	T	2: 92,367,022	M411K	probably damaging	Het
Lingo1	A	G	9: 56,620,183	V374A	probably benign	Het
Lrch1	A	G	14: 74,785,522	V637A	probably damaging	Het
Lyar	T	C	5: 38,224,680	V2A	probably damaging	Het
Nell1	C	T	7: 50,448,844	S298L	unknown	Het
Ogfod3	T	A	11: 121,195,205	I188F	probably damaging	Het
Olfr1487	T	A	19: 13,619,405	M81K	possibly damaging	Het
Olfr173	T	C	16: 58,797,175	T224A	probably benign	Het
Opa3	C	A	7: 19,245,036	A142E	possibly damaging	Het
Pald1	T	C	10: 61,323,346	R769G	probably benign	Het
Pappa2	T	A	1: 158,957,183	T86S	unknown	Het
Papss1	T	C	3: 131,602,050	Y266H	probably damaging	Het
Pcdhga7	C	A	18: 37,716,941	A667D	probably damaging	Het
Pcsk5	T	A	19: 17,433,731	T1766S	probably benign	Het
Pds5b	T	A	5: 150,794,282	N1129K	possibly damaging	Het
Pop7	T	C	5: 137,501,690	N127S	probably damaging	Het
Ppfibp2	A	G	7: 107,717,718	E300G	probably damaging	Het
Ppp4r3b	A	G	11: 29,182,507	K87E	probably damaging	Het
Psmd3	T	A	11: 98,682,833	M35K	possibly damaging	Het
Pus7	A	G	5: 23,775,679	V191A	probably damaging	Het
Rptor	C	T	11: 119,874,186		probably benign	Het
Sacs	A	G	14: 61,208,928	M2808V	probably benign	Het
Scube3	G	A	17: 28,167,599	V831I	probably benign	Het
Slc12a3	A	G	8: 94,365,944	T998A	probably damaging	Het
Slc4a1	T	C	11: 102,356,258	N501S	probably benign	Het
Sltm	G	A	9: 70,559,066	G94R	probably damaging	Het
Smc4	T	A	3: 69,027,502	W650R	probably damaging	Het
Smg7	A	G	1: 152,848,850	S527P	probably damaging	Het
Tcf20	T	C	15: 82,856,078	N391D	probably damaging	Het
Tiam2	G	A	17: 3,448,483	V845M	probably damaging	Het
Tln2	A	G	9: 67,346,417	F793L	probably benign	Het
Uckl1	T	C	2: 181,574,244	I193V	probably damaging	Het
Ugt1a5	A	G	1: 88,166,355	M102V	probably benign	Het
Usp38	G	A	8: 81,001,121	P328S	possibly damaging	Het
Vmn1r189	A	G	13: 22,102,115	V184A	possibly damaging	Het
Vps13d	C	A	4: 145,163,344	A597S	probably benign	Het
Wdr47	T	A	3: 108,618,524	L121Q	probably damaging	Het
Wiz	A	G	17: 32,361,533	S315P	probably damaging	Het
Zc3h13	T	C	14: 75,331,157	S1297P	probably damaging	Het
Zfp27	AATCCGCTTGTGCA	AA	7: 29,895,021		probably benign	Het

Other mutations in Sin3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Sin3a	APN	9	57097901	missense	probably damaging	1.00
IGL00836:Sin3a	APN	9	57107345	splice site	probably null
IGL00913:Sin3a	APN	9	57098118	missense	probably benign	0.01
IGL01721:Sin3a	APN	9	57095325	missense	probably damaging	1.00
IGL01964:Sin3a	APN	9	57107347	splice site	probably benign
IGL02333:Sin3a	APN	9	57107559	missense	possibly damaging	0.86
IGL02673:Sin3a	APN	9	57107441	missense	probably damaging	0.99
Delicate	UTSW	9	57103929	missense	probably damaging	1.00
IGL03014:Sin3a	UTSW	9	57095255	intron	probably benign
PIT4519001:Sin3a	UTSW	9	57095456	missense	possibly damaging	0.86
R0024:Sin3a	UTSW	9	57118253	intron	probably benign
R0309:Sin3a	UTSW	9	57110912	missense	probably benign	0.00
R0511:Sin3a	UTSW	9	57096895	nonsense	probably null
R1205:Sin3a	UTSW	9	57119175	missense	probably damaging	1.00
R1365:Sin3a	UTSW	9	57125203	nonsense	probably null
R1496:Sin3a	UTSW	9	57119158	missense	possibly damaging	0.77
R1544:Sin3a	UTSW	9	57103997	splice site	probably benign
R1958:Sin3a	UTSW	9	57105609	missense	probably damaging	1.00
R1993:Sin3a	UTSW	9	57101199	missense	probably damaging	1.00
R2037:Sin3a	UTSW	9	57096825	missense	probably benign	0.14
R2065:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R2079:Sin3a	UTSW	9	57089523	missense	probably benign
R2193:Sin3a	UTSW	9	57117477	missense	possibly damaging	0.93
R3004:Sin3a	UTSW	9	57096834	nonsense	probably null
R3929:Sin3a	UTSW	9	57118137	missense	probably damaging	0.98
R4326:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4327:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4329:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4765:Sin3a	UTSW	9	57096803	missense	probably benign	0.14
R4806:Sin3a	UTSW	9	57086742	missense	probably damaging	0.99
R4979:Sin3a	UTSW	9	57118076	missense	probably damaging	1.00
R5018:Sin3a	UTSW	9	57110891	missense	probably benign	0.00
R5368:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R5379:Sin3a	UTSW	9	57110988	missense	probably benign	0.10
R5391:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5395:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5519:Sin3a	UTSW	9	57118173	critical splice donor site	probably null
R5927:Sin3a	UTSW	9	57111111	missense	probably damaging	1.00
R5987:Sin3a	UTSW	9	57127200	missense	possibly damaging	0.75
R6083:Sin3a	UTSW	9	57107540	missense	probably damaging	1.00
R6161:Sin3a	UTSW	9	57095424	missense	possibly damaging	0.48
R6196:Sin3a	UTSW	9	57103929	missense	probably damaging	1.00
R6374:Sin3a	UTSW	9	57117481	missense	probably benign
R6456:Sin3a	UTSW	9	57113701	missense	possibly damaging	0.79
R6815:Sin3a	UTSW	9	57117540	missense	probably benign	0.02
R6900:Sin3a	UTSW	9	57107574	missense	probably damaging	1.00
R7081:Sin3a	UTSW	9	57094471	missense	probably null	1.00
R7285:Sin3a	UTSW	9	57127299	missense	possibly damaging	0.57
R7462:Sin3a	UTSW	9	57095525	missense	probably benign	0.00
R7538:Sin3a	UTSW	9	57103926	missense	possibly damaging	0.95
RF017:Sin3a	UTSW	9	57127326	missense	possibly damaging	0.90
X0026:Sin3a	UTSW	9	57125192	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACTGTGCCTCATGTGCACAC -3'
(R):5'- AAAAGGCCCTTCTGACGCTG -3'

Sequencing Primer
(F):5'- GAGAGAGGTTACAGCATCCTATTGTC -3'
(R):5'- CTGACGCTGAAACTTGTGATAACAC -3'

Posted On

2019-05-13