Mutagenetix > Incidental Mutation

Incidental Mutation 'R7051:Atp8b3'

547603

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R7051 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80520024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1285 (E1285K)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000051773] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: E1285K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: E1285K

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051773

SMART Domains

Protein: ENSMUSP00000053288
Gene: ENSMUSG00000045518

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
low complexity region	56	76	N/A	INTRINSIC
low complexity region	98	116	N/A	INTRINSIC
low complexity region	126	151	N/A	INTRINSIC
low complexity region	190	227	N/A	INTRINSIC
CUT	310	395	1.24e-42	SMART
HOX	411	473	1.07e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220326

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

95% (80/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5930422O12Rik	C	T	8: 33,429,173	S7L	unknown	Het
Aggf1	T	C	13: 95,351,617	K674R	possibly damaging	Het
Ampd1	T	C	3: 103,090,073	F264L	probably damaging	Het
Ankle1	A	T	8: 71,407,743	S302C	probably damaging	Het
Ankrd17	G	A	5: 90,366,451		probably benign	Het
Arhgap18	T	A	10: 26,849,921	N47K	possibly damaging	Het
Atp5f1	T	C	3: 105,943,767	N205D	probably benign	Het
Cacna1a	G	A	8: 84,629,915	R1929Q	possibly damaging	Het
Cadm2	C	T	16: 66,882,879	S22N	possibly damaging	Het
Ccdc177	C	T	12: 80,759,153	V116M	probably damaging	Het
Cdkl2	A	T	5: 92,033,225	I185N	probably damaging	Het
Cfhr2	T	A	1: 139,810,978	I282L	probably benign	Het
Clns1a	T	A	7: 97,712,617		probably null	Het
Commd2	A	T	3: 57,646,686	I198N	probably damaging	Het
Creb3l2	C	T	6: 37,336,265	V365I	possibly damaging	Het
Dcaf6	A	T	1: 165,424,317	N79K	possibly damaging	Het
Dlg5	T	C	14: 24,146,195	N1622D	possibly damaging	Het
Dock7	C	T	4: 98,946,732	R1802H	probably damaging	Het
Dpy19l2	T	C	9: 24,584,493	K643R	probably benign	Het
Dscam	G	A	16: 96,819,786	T574M	probably benign	Het
Fam209	A	G	2: 172,474,049	T115A	probably damaging	Het
Fastkd5	C	T	2: 130,614,417	C751Y	probably damaging	Het
Fat3	C	A	9: 16,377,827	L133F	probably damaging	Het
Frmd6	T	C	12: 70,897,396	V516A	possibly damaging	Het
Fry	G	A	5: 150,395,169	D955N	possibly damaging	Het
Fuk	A	T	8: 110,890,339	I393N	probably damaging	Het
Gm281	A	G	14: 13,828,486	V758A		Het
Gm340	A	G	19: 41,585,752	D982G	probably benign	Het
Gm7298	T	C	6: 121,775,034		probably null	Het
Golga7b	T	A	19: 42,268,460	*168R	probably null	Het
Golim4	T	A	3: 75,893,002	Q395L	probably benign	Het
Gxylt2	T	A	6: 100,804,576	L404*	probably null	Het
Hist1h1e	A	G	13: 23,622,439	V20A	probably benign	Het
Ighmbp2	G	T	19: 3,261,462	S984R	probably damaging	Het
Irf8	C	T	8: 120,739,842	R9W	probably damaging	Het
Itga4	T	C	2: 79,318,126	V788A	possibly damaging	Het
Kifap3	G	A	1: 163,794,080	R99H	probably damaging	Het
Kiss1r	T	C	10: 79,918,854	S61P	probably damaging	Het
Krtap6-1	A	T	16: 89,031,718	M1L	unknown	Het
Large2	A	T	2: 92,367,022	M411K	probably damaging	Het
Lingo1	A	G	9: 56,620,183	V374A	probably benign	Het
Lrch1	A	G	14: 74,785,522	V637A	probably damaging	Het
Lyar	T	C	5: 38,224,680	V2A	probably damaging	Het
Nell1	C	T	7: 50,448,844	S298L	unknown	Het
Ogfod3	T	A	11: 121,195,205	I188F	probably damaging	Het
Olfr1487	T	A	19: 13,619,405	M81K	possibly damaging	Het
Olfr173	T	C	16: 58,797,175	T224A	probably benign	Het
Opa3	C	A	7: 19,245,036	A142E	possibly damaging	Het
Pald1	T	C	10: 61,323,346	R769G	probably benign	Het
Pappa2	T	A	1: 158,957,183	T86S	unknown	Het
Papss1	T	C	3: 131,602,050	Y266H	probably damaging	Het
Pcdhga7	C	A	18: 37,716,941	A667D	probably damaging	Het
Pcsk5	T	A	19: 17,433,731	T1766S	probably benign	Het
Pds5b	T	A	5: 150,794,282	N1129K	possibly damaging	Het
Pop7	T	C	5: 137,501,690	N127S	probably damaging	Het
Ppfibp2	A	G	7: 107,717,718	E300G	probably damaging	Het
Ppp4r3b	A	G	11: 29,182,507	K87E	probably damaging	Het
Psmd3	T	A	11: 98,682,833	M35K	possibly damaging	Het
Pus7	A	G	5: 23,775,679	V191A	probably damaging	Het
Rptor	C	T	11: 119,874,186		probably benign	Het
Sacs	A	G	14: 61,208,928	M2808V	probably benign	Het
Scube3	G	A	17: 28,167,599	V831I	probably benign	Het
Sin3a	A	T	9: 57,103,934	N492Y	probably damaging	Het
Slc12a3	A	G	8: 94,365,944	T998A	probably damaging	Het
Slc4a1	T	C	11: 102,356,258	N501S	probably benign	Het
Sltm	G	A	9: 70,559,066	G94R	probably damaging	Het
Smc4	T	A	3: 69,027,502	W650R	probably damaging	Het
Smg7	A	G	1: 152,848,850	S527P	probably damaging	Het
Tcf20	T	C	15: 82,856,078	N391D	probably damaging	Het
Tiam2	G	A	17: 3,448,483	V845M	probably damaging	Het
Tln2	A	G	9: 67,346,417	F793L	probably benign	Het
Uckl1	T	C	2: 181,574,244	I193V	probably damaging	Het
Ugt1a5	A	G	1: 88,166,355	M102V	probably benign	Het
Usp38	G	A	8: 81,001,121	P328S	possibly damaging	Het
Vmn1r189	A	G	13: 22,102,115	V184A	possibly damaging	Het
Vps13d	C	A	4: 145,163,344	A597S	probably benign	Het
Wdr47	T	A	3: 108,618,524	L121Q	probably damaging	Het
Wiz	A	G	17: 32,361,533	S315P	probably damaging	Het
Zc3h13	T	C	14: 75,331,157	S1297P	probably damaging	Het
Zfp27	AATCCGCTTGTGCA	AA	7: 29,895,021		probably benign	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGGGCCTCTGGTCAACTTTG -3'
(R):5'- CCGAAGAAGACATTCCCTTGC -3'

Sequencing Primer
(F):5'- CAACTTTGCTTTCTGGGGAC -3'
(R):5'- CAGTATTTAATCCGCGGAAGATCTCC -3'

Posted On

2019-05-13