Incidental Mutation 'R7051:Hist1h1e'
ID547612
Institutional Source Beutler Lab
Gene Symbol Hist1h1e
Ensembl Gene ENSMUSG00000051627
Gene Namehistone cluster 1, H1e
SynonymsH1-4, H1var2, H1s-4, H1f4, H1e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7051 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23620629-23622558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23622439 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 20 (V20A)
Ref Sequence ENSEMBL: ENSMUSP00000057308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051091] [ENSMUST00000062045] [ENSMUST00000091704]
Predicted Effect probably benign
Transcript: ENSMUST00000051091
SMART Domains Protein: ENSMUSP00000061247
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062045
AA Change: V20A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000057308
Gene: ENSMUSG00000051627
AA Change: V20A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
H15 34 99 7.5e-23 SMART
low complexity region 116 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091704
SMART Domains Protein: ENSMUSP00000089296
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are normal, but Hist1h1e/Hist1h1c double knockout males are significantly smaller than normal. The Hist1h1e/Hist1h1d/Hist1h1e triple knockout is lethal by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Aggf1 T C 13: 95,351,617 K674R possibly damaging Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Clns1a T A 7: 97,712,617 probably null Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Itga4 T C 2: 79,318,126 V788A possibly damaging Het
Kifap3 G A 1: 163,794,080 R99H probably damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Large2 A T 2: 92,367,022 M411K probably damaging Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr1487 T A 19: 13,619,405 M81K possibly damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Papss1 T C 3: 131,602,050 Y266H probably damaging Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Rptor C T 11: 119,874,186 probably benign Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Tcf20 T C 15: 82,856,078 N391D probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Hist1h1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hist1h1e APN 13 23622022 unclassified probably benign
IGL03354:Hist1h1e APN 13 23622077 unclassified probably benign
PIT4469001:Hist1h1e UTSW 13 23622379 missense probably damaging 1.00
R2339:Hist1h1e UTSW 13 23621960 unclassified probably benign
R3110:Hist1h1e UTSW 13 23621846 unclassified probably benign
R3112:Hist1h1e UTSW 13 23621846 unclassified probably benign
R3757:Hist1h1e UTSW 13 23622257 nonsense probably null
R3758:Hist1h1e UTSW 13 23622257 nonsense probably null
R5116:Hist1h1e UTSW 13 23622287 missense probably damaging 1.00
R6034:Hist1h1e UTSW 13 23622313 missense probably damaging 1.00
R6034:Hist1h1e UTSW 13 23622313 missense probably damaging 1.00
R7008:Hist1h1e UTSW 13 23622209 missense probably damaging 1.00
R7317:Hist1h1e UTSW 13 23622367 missense probably damaging 1.00
R8220:Hist1h1e UTSW 13 23621939 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCTTCAGGCCGAGCTTGATG -3'
(R):5'- CACAACTCCGCATCTGAGAG -3'

Sequencing Primer
(F):5'- GATGCGGCTGTTGTTCTTCTCC -3'
(R):5'- TCCGCATCTGAGAGGACACTC -3'
Posted On2019-05-13