Incidental Mutation 'R7051:Aggf1'
ID547613
Institutional Source Beutler Lab
Gene Symbol Aggf1
Ensembl Gene ENSMUSG00000021681
Gene Nameangiogenic factor with G patch and FHA domains 1
Synonyms2010009L17Rik, 2310029P06Rik, VG5Q
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R7051 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95350683-95375352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95351617 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 674 (K674R)
Ref Sequence ENSEMBL: ENSMUSP00000022189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022189]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022189
AA Change: K674R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022189
Gene: ENSMUSG00000021681
AA Change: K674R

DomainStartEndE-ValueType
coiled coil region 20 85 N/A INTRINSIC
low complexity region 128 137 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
internal_repeat_1 205 225 4.68e-9 PROSPERO
internal_repeat_1 221 241 4.68e-9 PROSPERO
low complexity region 270 280 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 380 401 N/A INTRINSIC
FHA 430 484 1.51e-9 SMART
low complexity region 548 561 N/A INTRINSIC
G_patch 614 660 1.31e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor that promotes proliferation of endothelial cells. Mutations in this gene are associated with a susceptibility to Klippel-Trenaunay syndrome. Pseudogenes of this gene are found on chromosomes 3, 4, 10 and 16.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null embryos die before E8.5. Heterozygotes exhibit defective angiogenesis in yolk sacs and embryos and partial lethality. Surviving adults show hemorrhages, increased vascular permeability, and reduced tumor growth of implanted melanoma cell lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Clns1a T A 7: 97,712,617 probably null Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Hist1h1e A G 13: 23,622,439 V20A probably benign Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Itga4 T C 2: 79,318,126 V788A possibly damaging Het
Kifap3 G A 1: 163,794,080 R99H probably damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Large2 A T 2: 92,367,022 M411K probably damaging Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr1487 T A 19: 13,619,405 M81K possibly damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Papss1 T C 3: 131,602,050 Y266H probably damaging Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Rptor C T 11: 119,874,186 probably benign Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Tcf20 T C 15: 82,856,078 N391D probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Aggf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Aggf1 APN 13 95362477 missense probably damaging 1.00
IGL01083:Aggf1 APN 13 95356409 missense probably damaging 1.00
IGL01296:Aggf1 APN 13 95353971 missense probably damaging 1.00
IGL01811:Aggf1 APN 13 95351572 missense probably benign 0.04
IGL02089:Aggf1 APN 13 95370929 missense probably benign 0.22
IGL02351:Aggf1 APN 13 95352850 splice site probably benign
IGL02358:Aggf1 APN 13 95352850 splice site probably benign
IGL02534:Aggf1 APN 13 95369522 missense possibly damaging 0.76
PIT4687001:Aggf1 UTSW 13 95364875 missense probably damaging 0.99
R0090:Aggf1 UTSW 13 95364959 missense probably benign 0.01
R0189:Aggf1 UTSW 13 95356480 splice site probably benign
R0332:Aggf1 UTSW 13 95369446 missense probably damaging 1.00
R0334:Aggf1 UTSW 13 95371597 missense probably benign 0.02
R0445:Aggf1 UTSW 13 95354001 missense possibly damaging 0.74
R0523:Aggf1 UTSW 13 95356416 missense probably damaging 0.99
R0575:Aggf1 UTSW 13 95368397 missense probably benign 0.02
R0647:Aggf1 UTSW 13 95371656 splice site probably null
R1401:Aggf1 UTSW 13 95364848 missense probably benign 0.02
R1495:Aggf1 UTSW 13 95356413 nonsense probably null
R1542:Aggf1 UTSW 13 95370942 missense probably benign 0.00
R1688:Aggf1 UTSW 13 95364767 missense probably damaging 1.00
R2225:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R2226:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R4405:Aggf1 UTSW 13 95371594 missense probably benign 0.00
R4764:Aggf1 UTSW 13 95364713 missense probably damaging 0.96
R5819:Aggf1 UTSW 13 95351621 missense possibly damaging 0.76
R5878:Aggf1 UTSW 13 95369557 missense probably benign 0.18
R5946:Aggf1 UTSW 13 95371576 missense probably damaging 1.00
R6056:Aggf1 UTSW 13 95371615 missense probably benign 0.00
R6823:Aggf1 UTSW 13 95364723 missense probably benign 0.11
R7638:Aggf1 UTSW 13 95356413 nonsense probably null
R7682:Aggf1 UTSW 13 95368426 missense probably benign 0.41
R7903:Aggf1 UTSW 13 95356458 missense probably damaging 1.00
RF014:Aggf1 UTSW 13 95370768 missense possibly damaging 0.87
X0010:Aggf1 UTSW 13 95364977 missense probably benign
X0064:Aggf1 UTSW 13 95362870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCAGTGACTGACTTTCTAGG -3'
(R):5'- TATCTCTGAGTCCTTGGGCG -3'

Sequencing Primer
(F):5'- GTGACTGACTTTCTAGGAACACAGC -3'
(R):5'- CGTGTTTGAAGGATTACAGTCAAG -3'
Posted On2019-05-13