Incidental Mutation 'R7051:Tcf20'
ID547619
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Nametranscription factor 20
Synonymsstromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R7051 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82808436-82987872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82856078 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 391 (N391D)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
Predicted Effect probably damaging
Transcript: ENSMUST00000048966
AA Change: N391D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: N391D

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109510
AA Change: N391D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: N391D

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Aggf1 T C 13: 95,351,617 K674R possibly damaging Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Clns1a T A 7: 97,712,617 probably null Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Hist1h1e A G 13: 23,622,439 V20A probably benign Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Itga4 T C 2: 79,318,126 V788A possibly damaging Het
Kifap3 G A 1: 163,794,080 R99H probably damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Large2 A T 2: 92,367,022 M411K probably damaging Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr1487 T A 19: 13,619,405 M81K possibly damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Papss1 T C 3: 131,602,050 Y266H probably damaging Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Rptor C T 11: 119,874,186 probably benign Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82851584 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82854199 missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82856185 missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82851957 missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7486:Tcf20 UTSW 15 82853734 missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82852937 missense probably benign 0.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
R8447:Tcf20 UTSW 15 82853236 missense possibly damaging 0.77
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTGATGGAGTTGGACTGAGC -3'
(R):5'- CAGGCAAAGATTCCACCAGG -3'

Sequencing Primer
(F):5'- CTGGGGCATTAGCTGTAAAATTC -3'
(R):5'- GGCAGCAGCAGCAACAGC -3'
Posted On2019-05-13