Incidental Mutation 'R7051:Olfr1487'
ID547629
Institutional Source Beutler Lab
Gene Symbol Olfr1487
Ensembl Gene ENSMUSG00000094846
Gene Nameolfactory receptor 1487
SynonymsMOR202-18, GA_x6K02T2RE5P-3951719-3952666
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7051 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13617375-13623072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13619405 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 81 (M81K)
Ref Sequence ENSEMBL: ENSMUSP00000149988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076856] [ENSMUST00000208347] [ENSMUST00000209005] [ENSMUST00000216688] [ENSMUST00000217061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076856
AA Change: M81K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076128
Gene: ENSMUSG00000094846
AA Change: M81K

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1e-6 PFAM
Pfam:7tm_1 40 289 9.5e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208347
AA Change: M38K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209005
AA Change: M38K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216688
AA Change: M38K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217061
AA Change: M81K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.5344 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Aggf1 T C 13: 95,351,617 K674R possibly damaging Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Clns1a T A 7: 97,712,617 probably null Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Hist1h1e A G 13: 23,622,439 V20A probably benign Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Itga4 T C 2: 79,318,126 V788A possibly damaging Het
Kifap3 G A 1: 163,794,080 R99H probably damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Large2 A T 2: 92,367,022 M411K probably damaging Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Papss1 T C 3: 131,602,050 Y266H probably damaging Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Rptor C T 11: 119,874,186 probably benign Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Tcf20 T C 15: 82,856,078 N391D probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Olfr1487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr1487 APN 19 13619746 missense probably damaging 1.00
R0281:Olfr1487 UTSW 19 13619485 missense probably benign 0.00
R0847:Olfr1487 UTSW 19 13619551 missense probably benign 0.10
R1852:Olfr1487 UTSW 19 13619603 missense probably damaging 0.99
R2026:Olfr1487 UTSW 19 13619581 missense probably damaging 1.00
R2877:Olfr1487 UTSW 19 13619632 missense probably damaging 0.97
R3965:Olfr1487 UTSW 19 13619201 missense probably damaging 1.00
R4935:Olfr1487 UTSW 19 13619702 missense probably benign 0.11
R5148:Olfr1487 UTSW 19 13619510 nonsense probably null
R5210:Olfr1487 UTSW 19 13619399 missense probably damaging 1.00
R5427:Olfr1487 UTSW 19 13619350 missense probably benign 0.31
R5940:Olfr1487 UTSW 19 13619153 splice site probably null
R6110:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6125:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6294:Olfr1487 UTSW 19 13619366 missense probably benign 0.08
R7052:Olfr1487 UTSW 19 13619626 missense probably benign 0.13
R7324:Olfr1487 UTSW 19 13619578 missense probably benign
R7655:Olfr1487 UTSW 19 13619833 missense probably damaging 0.99
R7656:Olfr1487 UTSW 19 13619833 missense probably damaging 0.99
R7807:Olfr1487 UTSW 19 13619921 missense probably damaging 0.99
R7876:Olfr1487 UTSW 19 13619264 missense probably damaging 1.00
R8118:Olfr1487 UTSW 19 13619745 missense probably damaging 1.00
R8370:Olfr1487 UTSW 19 13619297 missense probably damaging 1.00
Z1176:Olfr1487 UTSW 19 13619662 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCATTCCTGCAAATTCC -3'
(R):5'- GTCCACTGACATAAGATCCAGC -3'

Sequencing Primer
(F):5'- TTGCTGATTCTGCTGGAC -3'
(R):5'- GCAGGACACATATCGTAGTTGTC -3'
Posted On2019-05-13