Mutagenetix > Incidental Mutation

Incidental Mutation 'R7052:Kcnt2'

547635

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

MMRRC Submission

045149-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R7052 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140383047 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 197 (N197S)

Ref Sequence

ENSEMBL: ENSMUSP00000113333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

AlphaFold

D3Z649

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119786
AA Change: N197S

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: N197S

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120709
AA Change: N197S

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: N197S

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120796
AA Change: N197S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: N197S

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	C	T	6: 142,658,535	R658H	probably benign	Het
Als2cl	C	T	9: 110,898,083	R906C	probably damaging	Het
Asb8	T	C	15: 98,136,401	H91R	probably damaging	Het
Atp8b3	C	T	10: 80,520,024	E1285K	probably benign	Het
Bves	G	A	10: 45,346,290	R172H	possibly damaging	Het
C6	A	T	15: 4,733,695	N59I	probably damaging	Het
Capn15	A	T	17: 25,961,750	V782D	probably damaging	Het
Ccdc18	T	C	5: 108,161,688	L383S	probably benign	Het
Coro6	C	A	11: 77,466,230	N119K	probably benign	Het
Cps1	T	A	1: 67,198,410	D1023E	probably damaging	Het
Dctn1	T	A	6: 83,195,280		probably null	Het
Ero1l	T	A	14: 45,306,583	K55*	probably null	Het
Fam209	G	A	2: 172,472,831	G80D	possibly damaging	Het
Fam71d	C	T	12: 78,719,402	T315I	probably benign	Het
Fam89b	G	A	19: 5,729,248	R94C	probably damaging	Het
Fut1	A	G	7: 45,619,757	*323W	probably null	Het
Gm47985	T	A	1: 151,183,139	F177Y	possibly damaging	Het
Gm8251	T	A	1: 44,057,306	Y1544F	possibly damaging	Het
Gstm7	T	A	3: 107,931,317	D37V	probably damaging	Het
H2-Aa	T	A	17: 34,284,510	S38C	possibly damaging	Het
Ighg2c	T	C	12: 113,288,723	T70A		Het
Ino80	A	G	2: 119,426,587		probably null	Het
Irf8	C	T	8: 120,739,842	R9W	probably damaging	Het
Kif11	T	A	19: 37,384,592	C86*	probably null	Het
Lonp1	A	T	17: 56,626,549	F109I	probably benign	Het
Mlkl	G	A	8: 111,319,442	S312L	possibly damaging	Het
Mroh9	T	A	1: 163,038,956	Q706L	possibly damaging	Het
Mtmr7	T	C	8: 40,555,833	H315R	possibly damaging	Het
Myh7b	G	C	2: 155,614,133	R146P	probably damaging	Het
Naip5	A	G	13: 100,222,347	Y794H	probably benign	Het
Nup153	A	T	13: 46,687,473	N886K	probably benign	Het
Nup205	A	G	6: 35,215,142	R1047G	possibly damaging	Het
Olfr1487	T	A	19: 13,619,626	S155T	probably benign	Het
Olfr768	T	C	10: 129,093,875	Y33C	probably damaging	Het
Oog3	A	T	4: 144,160,457	L31Q	probably damaging	Het
Palmd	T	C	3: 116,923,363	N495S	probably benign	Het
Patj	A	G	4: 98,677,260	Q1070R	probably benign	Het
Pax1	G	A	2: 147,365,904	R232H	probably damaging	Het
Pcdhb1	A	G	18: 37,266,529	N511S	probably damaging	Het
Pigs	C	T	11: 78,341,385	L448F	probably damaging	Het
Pih1d2	A	G	9: 50,621,777	Y235C	probably damaging	Het
Pkd2l2	T	A	18: 34,425,159	I297K	possibly damaging	Het
Pou2f1	C	T	1: 165,915,115	V82I	possibly damaging	Het
Pramel1	T	C	4: 143,396,504	L17P	probably damaging	Het
Riok1	C	T	13: 38,037,015		probably benign	Het
Scg3	C	A	9: 75,661,382	E358*	probably null	Het
Siglec15	T	C	18: 78,048,731	E85G	probably damaging	Het
Snx20	T	C	8: 88,629,978	H70R	probably benign	Het
Spi1	T	A	2: 91,113,340	S76R	probably damaging	Het
Stat5a	T	C	11: 100,879,285	S463P	probably damaging	Het
Svs2	A	G	2: 164,238,206	I13T	unknown	Het
Tmem132e	T	C	11: 82,437,363	S406P	probably damaging	Het
Top1mt	T	C	15: 75,668,711	N237S	possibly damaging	Het
Trav6d-4	G	A	14: 52,753,596	V30M	possibly damaging	Het
Trp73	A	T	4: 154,064,683	M217K	probably damaging	Het
Vmn1r58	A	G	7: 5,411,135	I32T	probably benign	Het
Vmn1r9	T	C	6: 57,071,411	M157T	probably benign	Het
Vmn2r100	C	T	17: 19,531,294	S533F	possibly damaging	Het
Vmn2r112	T	A	17: 22,602,526	M160K	probably benign	Het
Vps13d	C	A	4: 145,163,344	A597S	probably benign	Het
Zfp27	AATCCGCTTGTGCA	AA	7: 29,895,021		probably benign	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB002:Kcnt2	UTSW	1	140354509	nonsense	probably null
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8171:Kcnt2	UTSW	1	140509465	missense	probably benign	0.13
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
R8905:Kcnt2	UTSW	1	140507729	missense	possibly damaging	0.65
R8927:Kcnt2	UTSW	1	140428797	splice site	probably null
R8988:Kcnt2	UTSW	1	140428849	missense	probably benign	0.38
R9020:Kcnt2	UTSW	1	140584311	missense	probably benign	0.23
R9109:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9167:Kcnt2	UTSW	1	140578462	missense	probably benign	0.11
R9232:Kcnt2	UTSW	1	140484193	missense	possibly damaging	0.56
R9297:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9298:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9318:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9404:Kcnt2	UTSW	1	140425369	missense	probably damaging	1.00
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- ACCAAGTGAGCTGAATCTTAGC -3'
(R):5'- GCCAAATCCTTGTGACTTAGCTG -3'

Sequencing Primer
(F):5'- GAGCTGAATCTTAGCACTTTATGG -3'
(R):5'- AAATCCTTGTGACTTAGCTGTTTACC -3'

Posted On

2019-05-13