Incidental Mutation 'R7052:Kcnt2'
ID547635
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Namepotassium channel, subfamily T, member 2
SynonymsE330038N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7052 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location140246158-140612067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140383047 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 197 (N197S)
Ref Sequence ENSEMBL: ENSMUSP00000113333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119786
AA Change: N197S

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: N197S

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120709
AA Change: N197S

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: N197S

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120796
AA Change: N197S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: N197S

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Ccdc18 T C 5: 108,161,688 L383S probably benign Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Dctn1 T A 6: 83,195,280 probably null Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Fut1 A G 7: 45,619,757 *323W probably null Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Ino80 A G 2: 119,426,587 probably null Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Lonp1 A T 17: 56,626,549 F109I probably benign Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pax1 G A 2: 147,365,904 R232H probably damaging Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pou2f1 C T 1: 165,915,115 V82I possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Stat5a T C 11: 100,879,285 S463P probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Tmem132e T C 11: 82,437,363 S406P probably damaging Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140523098 missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140596051 missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140523211 missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140354555 critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140570417 missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140595998 missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140376383 missense probably benign
IGL02350:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140354561 splice site probably benign
IGL02483:Kcnt2 APN 1 140354561 splice site probably benign
IGL02866:Kcnt2 APN 1 140425248 missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140574806 missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140354507 missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140570455 missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140534002 intron probably benign
R0230:Kcnt2 UTSW 1 140246345 missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140351225 missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140509480 nonsense probably null
R0543:Kcnt2 UTSW 1 140609614 missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140507762 missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140573608 missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140428855 missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140383028 missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140484232 nonsense probably null
R1546:Kcnt2 UTSW 1 140431378 missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140425330 missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140584247 missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140584293 missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140425341 missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140553018 missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140375154 missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140552963 missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140428813 missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140509441 missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140530800 missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140573683 splice site probably null
R2442:Kcnt2 UTSW 1 140376353 missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140428884 missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140533968 missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140584287 missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140609630 missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140425332 missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140552980 missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140507747 missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140523148 missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140518897 missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140354516 missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140513025 nonsense probably null
R4973:Kcnt2 UTSW 1 140609650 missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140351256 missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140609615 missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140426901 missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140574743 missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140509496 missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140425366 missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140533928 missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140507702 missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140362980 missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140426923 nonsense probably null
R6248:Kcnt2 UTSW 1 140509478 missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140375112 missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140509584 missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140584106 missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140351227 missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140246193 unclassified probably benign
R6856:Kcnt2 UTSW 1 140596004 missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140584065 missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140512908 missense probably benign 0.01
R7138:Kcnt2 UTSW 1 140596040 missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140354517 missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140570478 missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140584055 missense probably damaging 0.99
R7541:Kcnt2 UTSW 1 140376384 missense probably benign 0.09
R7558:Kcnt2 UTSW 1 140523190 missense probably damaging 0.98
R7651:Kcnt2 UTSW 1 140570461 missense probably benign 0.40
R7730:Kcnt2 UTSW 1 140518948 missense probably benign 0.34
R7875:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7883:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R7958:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7966:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R8040:Kcnt2 UTSW 1 140450217 missense probably damaging 1.00
R8041:Kcnt2 UTSW 1 140609660 missense probably benign
X0062:Kcnt2 UTSW 1 140512991 missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140573646 missense probably damaging 1.00
Z1088:Kcnt2 UTSW 1 140584158 nonsense probably null
Z1176:Kcnt2 UTSW 1 140376361 missense probably damaging 1.00
Z1177:Kcnt2 UTSW 1 140609648 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ACCAAGTGAGCTGAATCTTAGC -3'
(R):5'- GCCAAATCCTTGTGACTTAGCTG -3'

Sequencing Primer
(F):5'- GAGCTGAATCTTAGCACTTTATGG -3'
(R):5'- AAATCCTTGTGACTTAGCTGTTTACC -3'
Posted On2019-05-13