Incidental Mutation 'R7052:Pou2f1'
ID547638
Institutional Source Beutler Lab
Gene Symbol Pou2f1
Ensembl Gene ENSMUSG00000026565
Gene NamePOU domain, class 2, transcription factor 1
Synonymsoct-1, Otf1, Oct-1C, Otf-1, Oct-1B, Oct1, Oct-1z, 2810482H01Rik, Oct-1A
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7052 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location165865154-166002678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 165915115 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 82 (V82I)
Ref Sequence ENSEMBL: ENSMUSP00000107055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027850] [ENSMUST00000069609] [ENSMUST00000111426] [ENSMUST00000111427] [ENSMUST00000111429] [ENSMUST00000159212] [ENSMUST00000160260] [ENSMUST00000160908] [ENSMUST00000177358] [ENSMUST00000184643]
Predicted Effect unknown
Transcript: ENSMUST00000027850
AA Change: V93I
SMART Domains Protein: ENSMUSP00000027850
Gene: ENSMUSG00000026565
AA Change: V93I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
POU 241 315 1.55e-52 SMART
low complexity region 316 332 N/A INTRINSIC
HOX 342 404 2.54e-19 SMART
low complexity region 422 448 N/A INTRINSIC
low complexity region 453 520 N/A INTRINSIC
low complexity region 529 567 N/A INTRINSIC
low complexity region 675 685 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000069609
AA Change: V82I
SMART Domains Protein: ENSMUSP00000064000
Gene: ENSMUSG00000026565
AA Change: V82I

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 505 572 N/A INTRINSIC
low complexity region 581 619 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111426
AA Change: V82I

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107055
Gene: ENSMUSG00000026565
AA Change: V82I

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 6.7e-55 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 1.3e-21 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111427
AA Change: V82I
SMART Domains Protein: ENSMUSP00000107056
Gene: ENSMUSG00000026565
AA Change: V82I

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
low complexity region 764 781 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111429
AA Change: V70I
SMART Domains Protein: ENSMUSP00000107057
Gene: ENSMUSG00000026565
AA Change: V70I

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159212
SMART Domains Protein: ENSMUSP00000125371
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 1.55e-52 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 2.54e-19 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
low complexity region 715 725 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160260
AA Change: V93I
SMART Domains Protein: ENSMUSP00000124738
Gene: ENSMUSG00000026565
AA Change: V93I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 542 607 N/A INTRINSIC
low complexity region 616 654 N/A INTRINSIC
low complexity region 762 772 N/A INTRINSIC
low complexity region 775 792 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160908
AA Change: V93I
SMART Domains Protein: ENSMUSP00000125444
Gene: ENSMUSG00000026565
AA Change: V93I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 516 583 N/A INTRINSIC
low complexity region 592 630 N/A INTRINSIC
low complexity region 738 748 N/A INTRINSIC
low complexity region 751 768 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177358
AA Change: V70I
SMART Domains Protein: ENSMUSP00000135565
Gene: ENSMUSG00000026565
AA Change: V70I

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184643
AA Change: V70I
SMART Domains Protein: ENSMUSP00000138962
Gene: ENSMUSG00000026565
AA Change: V70I

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The OCT1 transcription factor was among the first identified members of the POU transcription factor family (summarized by Sturm et al., 1993 [PubMed 8314572]). Members of this family contain the POU domain, a 160-amino acid region necessary for DNA binding to the octameric sequence ATGCAAAT.[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in prenatal lethality, with earlier lethality on either a 129/Sv or C57BL/6 background than a mixed 129/Sv and C57BL/6 background. Embryos show decreased erythropoiesis and partial penetrance of small lens size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Ccdc18 T C 5: 108,161,688 L383S probably benign Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Dctn1 T A 6: 83,195,280 probably null Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Fut1 A G 7: 45,619,757 *323W probably null Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Ino80 A G 2: 119,426,587 probably null Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kcnt2 A G 1: 140,383,047 N197S probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Lonp1 A T 17: 56,626,549 F109I probably benign Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pax1 G A 2: 147,365,904 R232H probably damaging Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Stat5a T C 11: 100,879,285 S463P probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Tmem132e T C 11: 82,437,363 S406P probably damaging Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Pou2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Pou2f1 APN 1 165902298 missense probably damaging 1.00
IGL00392:Pou2f1 APN 1 165896590 splice site probably benign
IGL01627:Pou2f1 APN 1 165880433 unclassified probably benign
IGL01707:Pou2f1 APN 1 165915116 missense probably damaging 0.96
IGL02735:Pou2f1 APN 1 165875827 missense probably damaging 1.00
IGL02740:Pou2f1 APN 1 165883116 nonsense probably null
IGL03117:Pou2f1 APN 1 165934813 missense probably benign 0.00
IGL03272:Pou2f1 APN 1 165896480 missense possibly damaging 0.67
R0021:Pou2f1 UTSW 1 165876018 missense probably damaging 1.00
R1437:Pou2f1 UTSW 1 165891830 missense probably damaging 0.98
R2171:Pou2f1 UTSW 1 165880356 unclassified probably benign
R3722:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3789:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3790:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3901:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R4225:Pou2f1 UTSW 1 165911320 missense possibly damaging 0.79
R4459:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4460:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4573:Pou2f1 UTSW 1 165913261 missense probably benign 0.29
R4820:Pou2f1 UTSW 1 165891948 intron probably benign
R4838:Pou2f1 UTSW 1 165916923 missense probably null 1.00
R5579:Pou2f1 UTSW 1 165915162 missense probably damaging 1.00
R5856:Pou2f1 UTSW 1 165915130 missense probably benign 0.14
R5951:Pou2f1 UTSW 1 165883056 unclassified probably benign
R6128:Pou2f1 UTSW 1 165875487 unclassified probably benign
R6145:Pou2f1 UTSW 1 165875433 unclassified probably benign
R6216:Pou2f1 UTSW 1 165880320 unclassified probably benign
R6971:Pou2f1 UTSW 1 165931689 missense probably damaging 0.98
R7403:Pou2f1 UTSW 1 165911386 missense unknown
R7404:Pou2f1 UTSW 1 165911386 missense unknown
R7741:Pou2f1 UTSW 1 165875875 missense probably damaging 0.98
R8011:Pou2f1 UTSW 1 165894903 critical splice donor site probably null
RF012:Pou2f1 UTSW 1 165913231 missense unknown
X0022:Pou2f1 UTSW 1 165896456 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCACCTTTGGCTCACACA -3'
(R):5'- ATGGCATGCTGACTGATGGT -3'

Sequencing Primer
(F):5'- TTTGGCTCACACACACAGCAG -3'
(R):5'- CAAAAGAAGTTCCTGTGGTTTTCAG -3'
Posted On2019-05-13