Mutagenetix > Incidental Mutations

Incidental Mutation 'R7052:Ino80'

547640

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R7052 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 119426587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]

AlphaFold

Q6ZPV2

Predicted Effect

probably null
Transcript: ENSMUST00000049920

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110808

SMART Domains

Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	272	412	8.8e-55	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
PDB:3MWY\|W	1098	1136	6e-7	PDB

Meta Mutation Damage Score

0.9499

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	C	T	6: 142,658,535	R658H	probably benign	Het
Als2cl	C	T	9: 110,898,083	R906C	probably damaging	Het
Asb8	T	C	15: 98,136,401	H91R	probably damaging	Het
Atp8b3	C	T	10: 80,520,024	E1285K	probably benign	Het
Bves	G	A	10: 45,346,290	R172H	possibly damaging	Het
C6	A	T	15: 4,733,695	N59I	probably damaging	Het
Capn15	A	T	17: 25,961,750	V782D	probably damaging	Het
Ccdc18	T	C	5: 108,161,688	L383S	probably benign	Het
Coro6	C	A	11: 77,466,230	N119K	probably benign	Het
Cps1	T	A	1: 67,198,410	D1023E	probably damaging	Het
Dctn1	T	A	6: 83,195,280		probably null	Het
Ero1l	T	A	14: 45,306,583	K55*	probably null	Het
Fam209	G	A	2: 172,472,831	G80D	possibly damaging	Het
Fam71d	C	T	12: 78,719,402	T315I	probably benign	Het
Fam89b	G	A	19: 5,729,248	R94C	probably damaging	Het
Fut1	A	G	7: 45,619,757	*323W	probably null	Het
Gm47985	T	A	1: 151,183,139	F177Y	possibly damaging	Het
Gm8251	T	A	1: 44,057,306	Y1544F	possibly damaging	Het
Gstm7	T	A	3: 107,931,317	D37V	probably damaging	Het
H2-Aa	T	A	17: 34,284,510	S38C	possibly damaging	Het
Ighg2c	T	C	12: 113,288,723	T70A		Het
Irf8	C	T	8: 120,739,842	R9W	probably damaging	Het
Kcnt2	A	G	1: 140,383,047	N197S	probably damaging	Het
Kif11	T	A	19: 37,384,592	C86*	probably null	Het
Lonp1	A	T	17: 56,626,549	F109I	probably benign	Het
Mlkl	G	A	8: 111,319,442	S312L	possibly damaging	Het
Mroh9	T	A	1: 163,038,956	Q706L	possibly damaging	Het
Mtmr7	T	C	8: 40,555,833	H315R	possibly damaging	Het
Myh7b	G	C	2: 155,614,133	R146P	probably damaging	Het
Naip5	A	G	13: 100,222,347	Y794H	probably benign	Het
Nup153	A	T	13: 46,687,473	N886K	probably benign	Het
Nup205	A	G	6: 35,215,142	R1047G	possibly damaging	Het
Olfr1487	T	A	19: 13,619,626	S155T	probably benign	Het
Olfr768	T	C	10: 129,093,875	Y33C	probably damaging	Het
Oog3	A	T	4: 144,160,457	L31Q	probably damaging	Het
Palmd	T	C	3: 116,923,363	N495S	probably benign	Het
Patj	A	G	4: 98,677,260	Q1070R	probably benign	Het
Pax1	G	A	2: 147,365,904	R232H	probably damaging	Het
Pcdhb1	A	G	18: 37,266,529	N511S	probably damaging	Het
Pigs	C	T	11: 78,341,385	L448F	probably damaging	Het
Pih1d2	A	G	9: 50,621,777	Y235C	probably damaging	Het
Pkd2l2	T	A	18: 34,425,159	I297K	possibly damaging	Het
Pou2f1	C	T	1: 165,915,115	V82I	possibly damaging	Het
Pramel1	T	C	4: 143,396,504	L17P	probably damaging	Het
Riok1	C	T	13: 38,037,015		probably benign	Het
Scg3	C	A	9: 75,661,382	E358*	probably null	Het
Siglec15	T	C	18: 78,048,731	E85G	probably damaging	Het
Snx20	T	C	8: 88,629,978	H70R	probably benign	Het
Spi1	T	A	2: 91,113,340	S76R	probably damaging	Het
Stat5a	T	C	11: 100,879,285	S463P	probably damaging	Het
Svs2	A	G	2: 164,238,206	I13T	unknown	Het
Tmem132e	T	C	11: 82,437,363	S406P	probably damaging	Het
Top1mt	T	C	15: 75,668,711	N237S	possibly damaging	Het
Trav6d-4	G	A	14: 52,753,596	V30M	possibly damaging	Het
Trp73	A	T	4: 154,064,683	M217K	probably damaging	Het
Vmn1r58	A	G	7: 5,411,135	I32T	probably benign	Het
Vmn1r9	T	C	6: 57,071,411	M157T	probably benign	Het
Vmn2r100	C	T	17: 19,531,294	S533F	possibly damaging	Het
Vmn2r112	T	A	17: 22,602,526	M160K	probably benign	Het
Vps13d	C	A	4: 145,163,344	A597S	probably benign	Het
Zfp27	AATCCGCTTGTGCA	AA	7: 29,895,021		probably benign	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9319:Ino80	UTSW	2	119374524	missense	probably benign	0.13
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTAAGGTTCTTAAGGCC -3'
(R):5'- TCCACAAGGGACAGTAATGACTG -3'

Sequencing Primer
(F):5'- CCATCTAATGGGAGCCTTAATAATGC -3'
(R):5'- GACTGACCATTTCTTTTCTTAGGTG -3'

Posted On

2019-05-13