Incidental Mutation 'R7052:Ino80'
ID547640
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7052 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 119426587 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
Predicted Effect probably null
Transcript: ENSMUST00000049920
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110808
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Ccdc18 T C 5: 108,161,688 L383S probably benign Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Dctn1 T A 6: 83,195,280 probably null Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Fut1 A G 7: 45,619,757 *323W probably null Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kcnt2 A G 1: 140,383,047 N197S probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Lonp1 A T 17: 56,626,549 F109I probably benign Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pax1 G A 2: 147,365,904 R232H probably damaging Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pou2f1 C T 1: 165,915,115 V82I possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Stat5a T C 11: 100,879,285 S463P probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Tmem132e T C 11: 82,437,363 S406P probably damaging Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTAAGGTTCTTAAGGCC -3'
(R):5'- TCCACAAGGGACAGTAATGACTG -3'

Sequencing Primer
(F):5'- CCATCTAATGGGAGCCTTAATAATGC -3'
(R):5'- GACTGACCATTTCTTTTCTTAGGTG -3'
Posted On2019-05-13