Incidental Mutation 'R7052:Pax1'
ID547641
Institutional Source Beutler Lab
Gene Symbol Pax1
Ensembl Gene ENSMUSG00000037034
Gene Namepaired box 1
SynonymsPax-1, hunchback, wavy tail, hbs, wt
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R7052 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location147361925-147393295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147365904 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 232 (R232H)
Ref Sequence ENSEMBL: ENSMUSP00000119667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109968] [ENSMUST00000126068]
Predicted Effect probably damaging
Transcript: ENSMUST00000109968
AA Change: R144H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105594
Gene: ENSMUSG00000037034
AA Change: R144H

DomainStartEndE-ValueType
low complexity region 9 55 N/A INTRINSIC
PAX 89 213 9.13e-91 SMART
low complexity region 380 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126068
AA Change: R232H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119667
Gene: ENSMUSG00000037034
AA Change: R232H

DomainStartEndE-ValueType
low complexity region 97 143 N/A INTRINSIC
PAX 177 301 9.13e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. This gene plays a role in pattern formation during embryogenesis and may be essential for development of the vertebral column. This gene is silenced by methylation in ovarian and cervical cancers and may be a tumor suppressor gene. Mutations in this gene are also associated with vertebral malformations. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for several mutations exhibit variably severe morphological alterations of vertebral column, sternum, scapula, skull, and thymus, with reduced adult survival and fertility. Some heterozygotes show milder skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Ccdc18 T C 5: 108,161,688 L383S probably benign Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Dctn1 T A 6: 83,195,280 probably null Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Fut1 A G 7: 45,619,757 *323W probably null Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Ino80 A G 2: 119,426,587 probably null Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kcnt2 A G 1: 140,383,047 N197S probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Lonp1 A T 17: 56,626,549 F109I probably benign Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pou2f1 C T 1: 165,915,115 V82I possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Stat5a T C 11: 100,879,285 S463P probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Tmem132e T C 11: 82,437,363 S406P probably damaging Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Pax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
wavy UTSW 2 147365802 missense probably damaging 1.00
R0030:Pax1 UTSW 2 147368582 missense probably damaging 0.99
R0147:Pax1 UTSW 2 147373734 missense probably benign 0.17
R0304:Pax1 UTSW 2 147366147 missense probably benign 0.20
R1544:Pax1 UTSW 2 147368401 missense probably damaging 0.99
R1583:Pax1 UTSW 2 147366255 missense possibly damaging 0.94
R1937:Pax1 UTSW 2 147367889 missense possibly damaging 0.78
R2143:Pax1 UTSW 2 147365882 missense probably damaging 1.00
R2208:Pax1 UTSW 2 147365802 missense probably damaging 1.00
R2915:Pax1 UTSW 2 147368428 missense probably damaging 1.00
R3878:Pax1 UTSW 2 147362308 unclassified probably benign
R4788:Pax1 UTSW 2 147366204 missense possibly damaging 0.94
R6323:Pax1 UTSW 2 147368401 missense probably damaging 1.00
R6842:Pax1 UTSW 2 147373720 missense probably benign 0.00
R7117:Pax1 UTSW 2 147366270 missense probably damaging 0.98
R7703:Pax1 UTSW 2 147366114 missense probably damaging 1.00
R8487:Pax1 UTSW 2 147365048 start codon destroyed probably null
Z1177:Pax1 UTSW 2 147368511 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGACACCCTTGAGTAACCC -3'
(R):5'- ACGTTGTACTTGTCACAAACG -3'

Sequencing Primer
(F):5'- GAGTAACCCGCCGGTGTTTTC -3'
(R):5'- TTGTACTTGTCACAAACGCCATCAG -3'
Posted On2019-05-13