Incidental Mutation 'R0611:Slc9c1'
ID 54765
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, Slc9a10, spermNHE
MMRRC Submission 038800-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock # R0611 (G1)
Quality Score 189
Status Not validated
Chromosome 16
Chromosomal Location 45535309-45607001 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45581602 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 784 (D784G)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000159945
AA Change: D784G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: D784G

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,252,256 M819K possibly damaging Het
Adamtsl3 T G 7: 82,528,912 C528G probably damaging Het
Akap9 A G 5: 3,954,870 K148E probably benign Het
Akr1b3 A T 6: 34,309,642 D225E probably benign Het
Alms1 C A 6: 85,678,671 Q2931K possibly damaging Het
Ano3 T C 2: 110,885,001 K31E possibly damaging Het
Cdc37 A G 9: 21,142,241 I242T probably damaging Het
Celsr1 T A 15: 85,932,323 K1806N possibly damaging Het
Clpb T A 7: 101,787,749 I707N possibly damaging Het
Cntnap2 A T 6: 47,095,549 Y1017F possibly damaging Het
Creb3l2 A T 6: 37,334,481 S458T probably benign Het
Ctnnd2 C A 15: 31,009,084 T1109K possibly damaging Het
Dcaf10 T A 4: 45,373,011 L425Q probably damaging Het
Dlec1 A G 9: 119,112,099 E239G probably benign Het
Dnah2 T C 11: 69,499,194 K742E probably damaging Het
Dsp A T 13: 38,187,741 R889S probably damaging Het
Dync1h1 T A 12: 110,632,788 M1859K probably damaging Het
Efcab7 T A 4: 99,901,689 N361K probably damaging Het
Eps8l2 T C 7: 141,355,733 V139A probably damaging Het
Fads3 T G 19: 10,041,836 H35Q probably damaging Het
Fam163b C A 2: 27,113,571 V24F probably damaging Het
Gm14496 A T 2: 181,995,111 T121S probably benign Het
Gm4799 C T 10: 82,954,729 noncoding transcript Het
Gm7168 A T 17: 13,949,535 D388V probably benign Het
Gmeb1 A T 4: 132,226,075 L460* probably null Het
Gpc6 T G 14: 117,975,018 F534V probably null Het
Hectd3 A G 4: 116,996,044 D156G possibly damaging Het
Itga6 T C 2: 71,820,060 I150T possibly damaging Het
Kansl1 A G 11: 104,338,186 M863T probably benign Het
Kcnb2 A T 1: 15,710,440 Y512F probably benign Het
Klhdc2 A T 12: 69,300,279 M73L probably benign Het
Ktn1 A G 14: 47,694,616 T667A probably benign Het
Lgsn A C 1: 31,203,655 I273L probably benign Het
Lilra5 A G 7: 4,242,233 D292G probably benign Het
Mrps27 C T 13: 99,405,074 R229C probably damaging Het
Muc5b T G 7: 141,862,436 S3040A probably benign Het
Nat14 T C 7: 4,923,276 S7P probably damaging Het
Nfia A G 4: 97,783,457 I135V possibly damaging Het
Nkd1 G A 8: 88,522,316 A30T probably damaging Het
Nup205 A G 6: 35,225,968 D1370G probably null Het
Olfr282 T C 15: 98,438,287 S273P possibly damaging Het
Olfr344 C G 2: 36,569,556 probably null Het
Olfr507 T A 7: 108,622,287 N158K possibly damaging Het
Olfr633 T C 7: 103,947,193 L209P probably damaging Het
Olfr726 G A 14: 50,083,853 T276I probably damaging Het
Orc1 C T 4: 108,602,032 A466V probably benign Het
Otud7a T A 7: 63,735,890 D367E possibly damaging Het
Pcdhb4 A G 18: 37,308,210 Y191C probably damaging Het
Pclo T C 5: 14,678,775 probably benign Het
Pclo T C 5: 14,712,814 V3767A unknown Het
Prmt1 A T 7: 44,978,801 probably null Het
Ralgapa1 A G 12: 55,795,698 F62S probably damaging Het
Rangrf T C 11: 68,972,692 S163G probably benign Het
Rgs12 C A 5: 35,019,460 A65E probably damaging Het
Rrbp1 T C 2: 143,988,516 N577S probably damaging Het
Sept11 A G 5: 93,167,534 H374R probably damaging Het
Serpina5 T G 12: 104,103,787 N314K probably benign Het
Sgce T C 6: 4,689,621 D395G probably damaging Het
Slc26a9 A T 1: 131,762,761 N501I probably damaging Het
Snapc2 A G 8: 4,255,676 D207G probably benign Het
Stard9 G T 2: 120,699,257 M1998I probably benign Het
Stk38 A C 17: 28,975,933 F280V possibly damaging Het
Tas2r126 A G 6: 42,435,091 K186R probably damaging Het
Tdp1 A C 12: 99,909,711 D307A probably benign Het
Tead2 A G 7: 45,217,250 D11G probably damaging Het
Tmco4 C A 4: 139,020,072 L211I probably damaging Het
Tmem183a A G 1: 134,352,377 F255S probably damaging Het
Tmem87a C T 2: 120,375,448 G349S possibly damaging Het
Tpte G A 8: 22,336,533 E377K possibly damaging Het
Trim32 T C 4: 65,613,656 F150S possibly damaging Het
Trpc7 T A 13: 56,887,823 K99M probably damaging Het
Ttc22 A G 4: 106,634,184 K195E probably damaging Het
Txn2 G A 15: 77,927,717 P7S probably damaging Het
Ubxn2a G A 12: 4,880,700 T220I probably damaging Het
Ufd1 A G 16: 18,814,876 N17S possibly damaging Het
Unc13a A G 8: 71,649,865 S958P probably damaging Het
Vmn1r202 T A 13: 22,501,654 M198L probably damaging Het
Vmn2r84 G A 10: 130,386,122 A743V probably damaging Het
Washc5 A G 15: 59,341,158 F891S probably damaging Het
Zfp708 T C 13: 67,070,311 T495A probably benign Het
Zfp81 A G 17: 33,334,619 I407T probably benign Het
Zswim5 T C 4: 116,986,677 probably null Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45580127 missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45599781 missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45577912 missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45550188 missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45593485 missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45575407 missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45560342 missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45580214 missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45547663 missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45580253 missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCTCGTACTGCGGCCACAAAG -3'
(R):5'- AGGATGCAAAGGCACCTTCCAG -3'

Sequencing Primer
(F):5'- gccacaaagcagagaaagag -3'
(R):5'- CTTCCAGGAAGCTCCTAGTATG -3'
Posted On 2013-07-11