Incidental Mutation 'R7052:Ccdc18'
ID547651
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Namecoiled-coil domain containing 18
Synonyms4932411G06Rik, 1700021E15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7052 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108132875-108233628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108161688 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 383 (L383S)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677] [ENSMUST00000197718]
Predicted Effect probably benign
Transcript: ENSMUST00000047677
AA Change: L383S

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: L383S

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197718
SMART Domains Protein: ENSMUSP00000142963
Gene: ENSMUSG00000056531

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Dctn1 T A 6: 83,195,280 probably null Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Fut1 A G 7: 45,619,757 *323W probably null Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Ino80 A G 2: 119,426,587 probably null Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kcnt2 A G 1: 140,383,047 N197S probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Lonp1 A T 17: 56,626,549 F109I probably benign Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pax1 G A 2: 147,365,904 R232H probably damaging Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pou2f1 C T 1: 165,915,115 V82I possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Stat5a T C 11: 100,879,285 S463P probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Tmem132e T C 11: 82,437,363 S406P probably damaging Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108180525 missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108180887 missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108202186 splice site probably benign
IGL01718:Ccdc18 APN 5 108201348 missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108202111 missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108148922 missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108136052 missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108171748 missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108135969 splice site probably benign
IGL02880:Ccdc18 APN 5 108135444 missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108228901 missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108212131 missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108158619 missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108161700 missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108173761 missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108173789 missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108174964 missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108180416 missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108135560 missense probably damaging 0.99
R0648:Ccdc18 UTSW 5 108174987 missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108163664 missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108202116 nonsense probably null
R1509:Ccdc18 UTSW 5 108188978 missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108191977 missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108212188 missense probably benign
R1663:Ccdc18 UTSW 5 108216090 missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108193802 missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108220837 missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108196042 missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108228995 missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108158528 nonsense probably null
R4079:Ccdc18 UTSW 5 108158528 nonsense probably null
R4244:Ccdc18 UTSW 5 108148972 nonsense probably null
R4409:Ccdc18 UTSW 5 108220842 nonsense probably null
R4428:Ccdc18 UTSW 5 108136077 missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108161529 missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108228960 missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108135441 missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108136141 missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108192003 missense probably benign
R5039:Ccdc18 UTSW 5 108158648 critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108140874 missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108206728 missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108163759 missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108171618 missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108174887 missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108161582 missense probably benign
R6359:Ccdc18 UTSW 5 108135525 missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108174954 missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108201348 missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108161746 missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108191924 missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108138930 missense probably benign
R6664:Ccdc18 UTSW 5 108168100 nonsense probably null
R6836:Ccdc18 UTSW 5 108197967 missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108161535 missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108173862 critical splice donor site probably null
R7058:Ccdc18 UTSW 5 108193798 missense probably benign
R7087:Ccdc18 UTSW 5 108196122 missense probably benign
R7117:Ccdc18 UTSW 5 108148969 missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108168106 missense probably benign
R7382:Ccdc18 UTSW 5 108139007 missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108220850 missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108206617 nonsense probably null
R7506:Ccdc18 UTSW 5 108163739 missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108229049 critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108228662 missense probably benign 0.00
X0024:Ccdc18 UTSW 5 108191922 missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108212197 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCTTCACAGGGAGTTAAAAGAAG -3'
(R):5'- CCACTGAGCAAGCAAGGGTG -3'

Sequencing Primer
(F):5'- AATGATTATGGCAATGAAAAACTCAG -3'
(R):5'- TGAGCAAGCAAGGGTGAGGAC -3'
Posted On2019-05-13