Incidental Mutation 'R7052:Fut1'
ID547657
Institutional Source Beutler Lab
Gene Symbol Fut1
Ensembl Gene ENSMUSG00000008461
Gene Namefucosyltransferase 1
SynonymsH transferase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7052 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45617289-45621059 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 45619757 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 323 (*323W)
Ref Sequence ENSEMBL: ENSMUSP00000147274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008605] [ENSMUST00000033099] [ENSMUST00000033100] [ENSMUST00000209379] [ENSMUST00000210150]
Predicted Effect probably null
Transcript: ENSMUST00000008605
AA Change: *378W
SMART Domains Protein: ENSMUSP00000008605
Gene: ENSMUSG00000008461
AA Change: *378W

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Glyco_transf_11 39 355 3.1e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033099
SMART Domains Protein: ENSMUSP00000033099
Gene: ENSMUSG00000030827

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FGF 44 169 3.95e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033100
SMART Domains Protein: ENSMUSP00000033100
Gene: ENSMUSG00000064158

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
Pfam:IZUMO 21 166 2.6e-53 PFAM
IG 167 253 2.43e-2 SMART
transmembrane domain 320 342 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209379
AA Change: *323W
Predicted Effect probably benign
Transcript: ENSMUST00000210150
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous null mice are viable and healthy, lack alpha(1,2)fucose residues from the apical surface of pancreatic acinar glands and are deficient in epididymal cell surface alpha(1,2)fucosylated glycans but show normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Ccdc18 T C 5: 108,161,688 L383S probably benign Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Dctn1 T A 6: 83,195,280 probably null Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Ino80 A G 2: 119,426,587 probably null Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kcnt2 A G 1: 140,383,047 N197S probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Lonp1 A T 17: 56,626,549 F109I probably benign Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pax1 G A 2: 147,365,904 R232H probably damaging Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pou2f1 C T 1: 165,915,115 V82I possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Stat5a T C 11: 100,879,285 S463P probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Tmem132e T C 11: 82,437,363 S406P probably damaging Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Fut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Fut1 APN 7 45619431 missense probably damaging 1.00
IGL02015:Fut1 APN 7 45618975 missense probably damaging 0.98
IGL02232:Fut1 APN 7 45619447 missense probably damaging 1.00
IGL02934:Fut1 APN 7 45618703 missense possibly damaging 0.49
IGL02976:Fut1 APN 7 45619320 missense probably damaging 1.00
IGL03091:Fut1 APN 7 45619527 missense probably damaging 1.00
IGL03169:Fut1 APN 7 45619033 missense probably benign 0.05
R0107:Fut1 UTSW 7 45618846 missense possibly damaging 0.50
R0107:Fut1 UTSW 7 45618846 missense possibly damaging 0.50
R1413:Fut1 UTSW 7 45619428 missense probably damaging 0.98
R2039:Fut1 UTSW 7 45618991 missense possibly damaging 0.62
R2403:Fut1 UTSW 7 45619219 missense probably benign 0.14
R2516:Fut1 UTSW 7 45619198 missense probably benign 0.03
R3429:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R3430:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R5775:Fut1 UTSW 7 45619462 missense probably damaging 1.00
R6244:Fut1 UTSW 7 45619306 missense possibly damaging 0.79
R6961:Fut1 UTSW 7 45619539 missense probably damaging 0.99
R8027:Fut1 UTSW 7 45618865 missense probably damaging 1.00
Z1177:Fut1 UTSW 7 45619229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACACGGTCTACCTTGCAAAC -3'
(R):5'- GCCCAGAGGTTCTAAGAAGAC -3'

Sequencing Primer
(F):5'- AACTTCACCCTGCCAGATTCGG -3'
(R):5'- TCGGAAGAGACTGTGGCTTAC -3'
Posted On2019-05-13