Incidental Mutation 'R7052:Tmem132e'
ID547670
Institutional Source Beutler Lab
Gene Symbol Tmem132e
Ensembl Gene ENSMUSG00000020701
Gene Nametransmembrane protein 132E
SynonymsLOC270893
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R7052 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82388900-82446332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82437363 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 406 (S406P)
Ref Sequence ENSEMBL: ENSMUSP00000052484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054245] [ENSMUST00000092852]
Predicted Effect probably damaging
Transcript: ENSMUST00000054245
AA Change: S406P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052484
Gene: ENSMUSG00000020701
AA Change: S406P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:TMEM132D_N 45 176 1.1e-52 PFAM
low complexity region 202 216 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
Pfam:TMEM132 451 797 1.7e-136 PFAM
low complexity region 827 837 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
Pfam:TMEM132D_C 867 944 2e-34 PFAM
low complexity region 967 998 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1036 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092852
AA Change: S314P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090528
Gene: ENSMUSG00000020701
AA Change: S314P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 226 236 N/A INTRINSIC
low complexity region 471 489 N/A INTRINSIC
low complexity region 735 745 N/A INTRINSIC
low complexity region 749 762 N/A INTRINSIC
transmembrane domain 798 820 N/A INTRINSIC
low complexity region 875 906 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
low complexity region 944 951 N/A INTRINSIC
Meta Mutation Damage Score 0.2122 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Ccdc18 T C 5: 108,161,688 L383S probably benign Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Dctn1 T A 6: 83,195,280 probably null Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Fut1 A G 7: 45,619,757 *323W probably null Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Ino80 A G 2: 119,426,587 probably null Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kcnt2 A G 1: 140,383,047 N197S probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Lonp1 A T 17: 56,626,549 F109I probably benign Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pax1 G A 2: 147,365,904 R232H probably damaging Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pou2f1 C T 1: 165,915,115 V82I possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Stat5a T C 11: 100,879,285 S463P probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Tmem132e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Tmem132e APN 11 82438374 missense probably damaging 1.00
IGL01586:Tmem132e APN 11 82434669 missense probably damaging 1.00
IGL01729:Tmem132e APN 11 82435116 missense possibly damaging 0.89
IGL02592:Tmem132e APN 11 82434636 missense probably damaging 1.00
R0029:Tmem132e UTSW 11 82444761 missense probably damaging 1.00
R0501:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R0612:Tmem132e UTSW 11 82443372 missense probably damaging 1.00
R0613:Tmem132e UTSW 11 82438338 missense probably damaging 1.00
R1311:Tmem132e UTSW 11 82444296 missense probably damaging 1.00
R1430:Tmem132e UTSW 11 82438296 missense probably damaging 1.00
R1607:Tmem132e UTSW 11 82437370 missense probably benign 0.39
R1710:Tmem132e UTSW 11 82443517 missense probably damaging 1.00
R1913:Tmem132e UTSW 11 82443417 missense probably damaging 1.00
R1951:Tmem132e UTSW 11 82445082 missense possibly damaging 0.84
R2018:Tmem132e UTSW 11 82445163 missense probably benign 0.26
R2051:Tmem132e UTSW 11 82440438 missense probably damaging 1.00
R2076:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R2100:Tmem132e UTSW 11 82444531 missense probably damaging 1.00
R2325:Tmem132e UTSW 11 82434515 missense probably damaging 1.00
R2924:Tmem132e UTSW 11 82444323 missense probably damaging 1.00
R3436:Tmem132e UTSW 11 82444330 missense probably damaging 1.00
R3437:Tmem132e UTSW 11 82444330 missense probably damaging 1.00
R4594:Tmem132e UTSW 11 82435068 missense possibly damaging 0.83
R4704:Tmem132e UTSW 11 82443531 missense probably damaging 0.97
R4754:Tmem132e UTSW 11 82444851 nonsense probably null
R4764:Tmem132e UTSW 11 82434512 missense probably damaging 0.99
R5245:Tmem132e UTSW 11 82442638 missense probably damaging 0.96
R5720:Tmem132e UTSW 11 82442450 splice site probably null
R5793:Tmem132e UTSW 11 82444858 missense probably damaging 1.00
R5984:Tmem132e UTSW 11 82445097 missense probably damaging 1.00
R6980:Tmem132e UTSW 11 82438386 critical splice donor site probably null
R7637:Tmem132e UTSW 11 82434516 missense probably damaging 1.00
R7918:Tmem132e UTSW 11 82445290 missense probably damaging 1.00
R8262:Tmem132e UTSW 11 82434840 missense probably benign 0.33
R8772:Tmem132e UTSW 11 82434311 missense probably damaging 0.99
Z1177:Tmem132e UTSW 11 82435178 missense probably damaging 1.00
Z1177:Tmem132e UTSW 11 82445104 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGAGGCTTTACTCCAGTTGG -3'
(R):5'- ATATGGACATATGCTCCGCC -3'

Sequencing Primer
(F):5'- CCAGTTGGTTGGGGGAGACTC -3'
(R):5'- TGGATGACTGTCAGCTCA -3'
Posted On2019-05-13