Incidental Mutation 'R7052:Stat5a'
ID547671
Institutional Source Beutler Lab
Gene Symbol Stat5a
Ensembl Gene ENSMUSG00000004043
Gene Namesignal transducer and activator of transcription 5A
SynonymsSTAT5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7052 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100859351-100885169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100879285 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 463 (S463P)
Ref Sequence ENSEMBL: ENSMUSP00000102980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000107356] [ENSMUST00000107357]
Predicted Effect probably damaging
Transcript: ENSMUST00000004145
AA Change: S463P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043
AA Change: S463P

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107356
AA Change: S463P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043
AA Change: S463P

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107357
AA Change: S463P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043
AA Change: S463P

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 141 330 4.5e-57 PFAM
Pfam:STAT_bind 332 582 1e-104 PFAM
SH2 587 688 1.55e-6 SMART
low complexity region 713 729 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are reduced in size and display abnormalities in both mammary gland structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Ccdc18 T C 5: 108,161,688 L383S probably benign Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Dctn1 T A 6: 83,195,280 probably null Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Fut1 A G 7: 45,619,757 *323W probably null Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Ino80 A G 2: 119,426,587 probably null Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kcnt2 A G 1: 140,383,047 N197S probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Lonp1 A T 17: 56,626,549 F109I probably benign Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pax1 G A 2: 147,365,904 R232H probably damaging Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pou2f1 C T 1: 165,915,115 V82I possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Tmem132e T C 11: 82,437,363 S406P probably damaging Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Stat5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Stat5a APN 11 100881072 missense probably damaging 1.00
IGL02021:Stat5a APN 11 100883889 missense probably damaging 1.00
IGL02032:Stat5a APN 11 100861828 missense probably damaging 0.99
IGL03108:Stat5a APN 11 100863139 nonsense probably null
IGL03160:Stat5a APN 11 100861845 missense possibly damaging 0.71
hohum UTSW 11 100874129 missense probably damaging 1.00
yawn UTSW 11 100879693 missense possibly damaging 0.50
R0098:Stat5a UTSW 11 100875626 missense probably damaging 0.98
R0362:Stat5a UTSW 11 100882083 missense probably benign 0.01
R0452:Stat5a UTSW 11 100863135 missense probably benign 0.20
R0520:Stat5a UTSW 11 100861426 missense probably damaging 0.98
R0815:Stat5a UTSW 11 100875082 splice site probably null
R1081:Stat5a UTSW 11 100881060 missense probably damaging 1.00
R1752:Stat5a UTSW 11 100884058 makesense probably null
R1774:Stat5a UTSW 11 100879286 missense probably damaging 1.00
R1868:Stat5a UTSW 11 100874129 missense probably damaging 1.00
R2152:Stat5a UTSW 11 100874090 missense probably benign 0.38
R2900:Stat5a UTSW 11 100874131 missense probably benign 0.18
R4023:Stat5a UTSW 11 100874926 nonsense probably null
R4791:Stat5a UTSW 11 100865463 missense probably damaging 1.00
R5396:Stat5a UTSW 11 100880583 missense probably damaging 1.00
R5641:Stat5a UTSW 11 100876808 missense probably benign 0.01
R5723:Stat5a UTSW 11 100882074 missense probably benign 0.00
R5896:Stat5a UTSW 11 100877057 missense possibly damaging 0.94
R6026:Stat5a UTSW 11 100880316 missense probably damaging 1.00
R7075:Stat5a UTSW 11 100879693 missense possibly damaging 0.50
R7568:Stat5a UTSW 11 100875024 missense possibly damaging 0.74
R7771:Stat5a UTSW 11 100863219 missense probably benign 0.34
R7801:Stat5a UTSW 11 100880317 missense probably damaging 1.00
R7814:Stat5a UTSW 11 100875027 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTGGGACACTAAGCATAAGC -3'
(R):5'- TTAGGACCTGCCAGCCAATG -3'

Sequencing Primer
(F):5'- GGGACACTAAGCATAAGCCAACAAG -3'
(R):5'- GCACTCGCCTCACCCTG -3'
Posted On2019-05-13