Incidental Mutation 'R7052:Lonp1'
ID547686
Institutional Source Beutler Lab
Gene Symbol Lonp1
Ensembl Gene ENSMUSG00000041168
Gene Namelon peptidase 1, mitochondrial
Synonyms1200017E13Rik, LON, Prss15
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7052 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56614301-56626903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56626549 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 109 (F109I)
Ref Sequence ENSEMBL: ENSMUSP00000041814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047226] [ENSMUST00000112979]
Predicted Effect probably benign
Transcript: ENSMUST00000047226
AA Change: F109I

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041814
Gene: ENSMUSG00000041168
AA Change: F109I

DomainStartEndE-ValueType
LON 111 357 3.95e-62 SMART
low complexity region 389 404 N/A INTRINSIC
AAA 504 649 1.81e-14 SMART
Pfam:Lon_C 725 938 1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112979
SMART Domains Protein: ENSMUSP00000108603
Gene: ENSMUSG00000040828

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:CATSPERD 38 766 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial matrix protein that belongs to the Lon family of ATP-dependent proteases. This protein mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides in the mitochondrial matrix. It may also have a chaperone function in the assembly of inner membrane protein complexes, and participate in the regulation of mitochondrial gene expression and maintenance of the integrity of the mitochondrial genome. Decreased expression of this gene has been noted in a patient with hereditary spastic paraplegia (PMID:18378094). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality with embryonic growth retardation, small size and decreased mitochondrial DNA content. Mice heterozygous for this allele exhibit reduced chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Ccdc18 T C 5: 108,161,688 L383S probably benign Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Dctn1 T A 6: 83,195,280 probably null Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Fut1 A G 7: 45,619,757 *323W probably null Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Ino80 A G 2: 119,426,587 probably null Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kcnt2 A G 1: 140,383,047 N197S probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pax1 G A 2: 147,365,904 R232H probably damaging Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pou2f1 C T 1: 165,915,115 V82I possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Stat5a T C 11: 100,879,285 S463P probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Tmem132e T C 11: 82,437,363 S406P probably damaging Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Lonp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lonp1 APN 17 56619265 missense probably damaging 1.00
IGL00934:Lonp1 APN 17 56614683 missense probably benign 0.21
IGL01065:Lonp1 APN 17 56615500 unclassified probably benign
IGL01343:Lonp1 APN 17 56615586 missense possibly damaging 0.93
IGL01734:Lonp1 APN 17 56616026 missense probably damaging 1.00
IGL02141:Lonp1 APN 17 56615086 missense probably benign 0.19
IGL02979:Lonp1 APN 17 56621940 missense probably benign 0.02
chaney UTSW 17 56622515 missense probably damaging 1.00
Karloff UTSW 17 56618406 missense probably benign
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0863:Lonp1 UTSW 17 56618331 missense probably damaging 1.00
R1343:Lonp1 UTSW 17 56620272 missense probably damaging 1.00
R1735:Lonp1 UTSW 17 56614956 missense probably damaging 1.00
R1975:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1976:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1977:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R2484:Lonp1 UTSW 17 56614659 missense probably damaging 1.00
R2895:Lonp1 UTSW 17 56615562 missense probably damaging 1.00
R3123:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3125:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3429:Lonp1 UTSW 17 56618337 missense probably damaging 1.00
R3726:Lonp1 UTSW 17 56618310 unclassified probably benign
R3767:Lonp1 UTSW 17 56621952 missense possibly damaging 0.80
R4618:Lonp1 UTSW 17 56622511 missense probably benign 0.03
R4859:Lonp1 UTSW 17 56626587 missense probably benign 0.00
R4951:Lonp1 UTSW 17 56620335 missense possibly damaging 0.64
R5208:Lonp1 UTSW 17 56617793 missense probably damaging 1.00
R5620:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R5621:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R5622:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R6131:Lonp1 UTSW 17 56614457 missense probably benign 0.01
R6377:Lonp1 UTSW 17 56621961 missense possibly damaging 0.90
R6692:Lonp1 UTSW 17 56619230 missense probably damaging 1.00
R7131:Lonp1 UTSW 17 56617814 missense probably damaging 1.00
R7295:Lonp1 UTSW 17 56622495 missense possibly damaging 0.70
R7739:Lonp1 UTSW 17 56626620 missense probably benign
R7792:Lonp1 UTSW 17 56622515 missense probably damaging 1.00
R8307:Lonp1 UTSW 17 56626573 missense probably benign 0.01
R8546:Lonp1 UTSW 17 56626702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCTCTTGCCTCAGAGTGG -3'
(R):5'- AGAACATCCTTCATCGGGCC -3'

Sequencing Primer
(F):5'- CTCAGAGTGGTGCGATGAC -3'
(R):5'- TGCGACATGTCAGCTCCCTG -3'
Posted On2019-05-13