Incidental Mutation 'R7053:Olfr1029'
ID547695
Institutional Source Beutler Lab
Gene Symbol Olfr1029
Ensembl Gene ENSMUSG00000059873
Gene Nameolfactory receptor 1029
SynonymsGA_x6K02T2Q125-47454152-47455126, MOR198-1P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85973895-85978913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85976014 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 257 (C257F)
Ref Sequence ENSEMBL: ENSMUSP00000150637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056849] [ENSMUST00000082191] [ENSMUST00000217244]
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082191
AA Change: C257F

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080828
Gene: ENSMUSG00000059873
AA Change: C257F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7tm_1 41 290 2.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217244
AA Change: C257F

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Olfr1029
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Olfr1029 APN 2 85975235 utr 5 prime probably benign
IGL02126:Olfr1029 APN 2 85976173 missense probably benign 0.00
IGL02584:Olfr1029 APN 2 85975875 missense probably damaging 0.96
IGL03410:Olfr1029 APN 2 85975420 missense probably damaging 0.99
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1499:Olfr1029 UTSW 2 85976028 missense possibly damaging 0.62
R1584:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R2925:Olfr1029 UTSW 2 85975781 nonsense probably null
R2970:Olfr1029 UTSW 2 85976110 missense possibly damaging 0.75
R4571:Olfr1029 UTSW 2 85975831 missense probably damaging 0.97
R5533:Olfr1029 UTSW 2 85975453 missense possibly damaging 0.78
R5654:Olfr1029 UTSW 2 85976156 missense probably benign 0.00
R5827:Olfr1029 UTSW 2 85975306 missense probably benign 0.00
R5967:Olfr1029 UTSW 2 85976191 missense probably benign 0.01
R6291:Olfr1029 UTSW 2 85975582 missense probably damaging 1.00
R6735:Olfr1029 UTSW 2 85975434 missense possibly damaging 0.81
R6897:Olfr1029 UTSW 2 85975356 missense possibly damaging 0.45
R7163:Olfr1029 UTSW 2 85975588 missense probably damaging 1.00
R7358:Olfr1029 UTSW 2 85975436 missense possibly damaging 0.81
R8047:Olfr1029 UTSW 2 85975927 missense possibly damaging 0.52
R8271:Olfr1029 UTSW 2 85975422 missense probably damaging 1.00
R8271:Olfr1029 UTSW 2 85975741 missense probably benign 0.40
R8364:Olfr1029 UTSW 2 85976014 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACCCACCACTTATTAAGCTATCTTG -3'
(R):5'- TGTTGGAAGGTGGACGCATC -3'

Sequencing Primer
(F):5'- CATGCCATGTTAATATCAGCTGG -3'
(R):5'- CATCAATGCTGTCCTGATGAC -3'
Posted On2019-05-13