Incidental Mutation 'R7053:Oasl2'
ID547701
Institutional Source Beutler Lab
Gene Symbol Oasl2
Ensembl Gene ENSMUSG00000029561
Gene Name2'-5' oligoadenylate synthetase-like 2
SynonymsMmu-OASL, M1204
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114896936-114912234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114911230 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 464 (I464L)
Ref Sequence ENSEMBL: ENSMUSP00000031542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031542] [ENSMUST00000124716]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031542
AA Change: I464L

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031542
Gene: ENSMUSG00000029561
AA Change: I464L

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Pfam:OAS1_C 169 351 8.4e-77 PFAM
SCOP:d1euvb_ 355 427 4e-4 SMART
Blast:UBQ 355 430 9e-30 BLAST
UBQ 435 506 8.88e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124716
SMART Domains Protein: ENSMUSP00000115070
Gene: ENSMUSG00000029561

DomainStartEndE-ValueType
Pfam:OAS1_C 1 131 1.2e-48 PFAM
SCOP:d1euvb_ 135 207 6e-5 SMART
Blast:UBQ 135 210 9e-32 BLAST
Blast:UBQ 215 240 5e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000144064
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Oasl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Oasl2 APN 5 114897806 missense probably damaging 1.00
IGL02649:Oasl2 APN 5 114897692 missense probably damaging 1.00
IGL02810:Oasl2 APN 5 114897791 missense probably damaging 1.00
IGL03153:Oasl2 APN 5 114901332 missense probably benign 0.02
R0179:Oasl2 UTSW 5 114910912 missense probably benign
R1318:Oasl2 UTSW 5 114901381 missense probably benign 0.01
R1831:Oasl2 UTSW 5 114901306 missense probably benign 0.00
R1941:Oasl2 UTSW 5 114911362 utr 3 prime probably benign
R2068:Oasl2 UTSW 5 114911237 missense probably benign 0.01
R2104:Oasl2 UTSW 5 114911002 nonsense probably null
R2170:Oasl2 UTSW 5 114906800 missense probably damaging 0.99
R2437:Oasl2 UTSW 5 114911296 missense probably benign
R2882:Oasl2 UTSW 5 114911023 missense probably damaging 1.00
R3960:Oasl2 UTSW 5 114905037 missense probably benign 0.03
R3962:Oasl2 UTSW 5 114897747 missense probably benign 0.01
R4609:Oasl2 UTSW 5 114899796 missense possibly damaging 0.47
R4761:Oasl2 UTSW 5 114899775 missense probably benign 0.00
R5242:Oasl2 UTSW 5 114905061 missense possibly damaging 0.92
R5691:Oasl2 UTSW 5 114899767 missense possibly damaging 0.93
R6594:Oasl2 UTSW 5 114906775 missense probably benign 0.30
R7062:Oasl2 UTSW 5 114911091 nonsense probably null
R7688:Oasl2 UTSW 5 114897848 missense probably benign 0.01
R7753:Oasl2 UTSW 5 114905057 missense probably benign
R8026:Oasl2 UTSW 5 114902268 unclassified probably benign
R8160:Oasl2 UTSW 5 114901286 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AACTGCGCATCTCCTTCCAG -3'
(R):5'- CCATCAGAGTCTAGGGATGAGGTAG -3'

Sequencing Primer
(F):5'- GGGGAGAGACAGCTGCTC -3'
(R):5'- TCTAGGGATGAGGTAGGGAGGC -3'
Posted On2019-05-13