Incidental Mutation 'R7053:Taok3'
ID547702
Institutional Source Beutler Lab
Gene Symbol Taok3
Ensembl Gene ENSMUSG00000061288
Gene NameTAO kinase 3
SynonymsA430105I05Rik, 2900006A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location117120129-117275219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117252562 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 529 (D529E)
Ref Sequence ENSEMBL: ENSMUSP00000136750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092889] [ENSMUST00000111975] [ENSMUST00000111978] [ENSMUST00000145640] [ENSMUST00000179276]
Predicted Effect probably benign
Transcript: ENSMUST00000092889
AA Change: D529E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090565
Gene: ENSMUSG00000061288
AA Change: D529E

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111975
AA Change: D69E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107606
Gene: ENSMUSG00000061288
AA Change: D69E

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
coiled coil region 158 189 N/A INTRINSIC
coiled coil region 329 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111978
AA Change: D529E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107609
Gene: ENSMUSG00000061288
AA Change: D529E

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145640
AA Change: D529E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116920
Gene: ENSMUSG00000061288
AA Change: D529E

DomainStartEndE-ValueType
S_TKc 24 277 2.2e-86 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179276
AA Change: D529E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136750
Gene: ENSMUSG00000061288
AA Change: D529E

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that activates the p38/MAPK14 stress-activated MAPK cascade but inhibits the basal activity of the MAPK8/JNK cascade. The encoded protein is a member of the GCK subfamily of STE20-like kinases. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Taok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Taok3 APN 5 117272197 missense probably benign 0.20
IGL01632:Taok3 APN 5 117265928 missense possibly damaging 0.95
IGL02894:Taok3 APN 5 117263613 missense probably benign 0.19
bonze UTSW 5 117272229 nonsense probably null
daoist UTSW 5 117209571 missense probably damaging 0.99
haller UTSW 5 117206655 missense probably damaging 1.00
Perseveration UTSW 5 117255863 missense probably benign 0.25
taoist UTSW 5 117206655 missense probably damaging 1.00
Three_treasures UTSW 5 117217242 critical splice donor site probably null
PIT4366001:Taok3 UTSW 5 117227985 missense probably benign 0.21
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0158:Taok3 UTSW 5 117217242 critical splice donor site probably null
R0245:Taok3 UTSW 5 117252679 splice site probably benign
R0371:Taok3 UTSW 5 117206687 nonsense probably null
R1140:Taok3 UTSW 5 117228053 missense possibly damaging 0.94
R1302:Taok3 UTSW 5 117199043 missense possibly damaging 0.46
R1376:Taok3 UTSW 5 117265961 missense probably damaging 1.00
R1376:Taok3 UTSW 5 117265961 missense probably damaging 1.00
R1387:Taok3 UTSW 5 117206655 missense probably damaging 1.00
R1711:Taok3 UTSW 5 117255926 missense possibly damaging 0.68
R1977:Taok3 UTSW 5 117265924 missense probably damaging 0.98
R2898:Taok3 UTSW 5 117200069 critical splice acceptor site probably null
R3824:Taok3 UTSW 5 117255937 missense probably benign 0.01
R4378:Taok3 UTSW 5 117209571 missense probably damaging 0.99
R4695:Taok3 UTSW 5 117228066 missense probably benign 0.11
R4882:Taok3 UTSW 5 117252630 missense probably damaging 0.99
R5286:Taok3 UTSW 5 117266075 missense probably damaging 1.00
R5522:Taok3 UTSW 5 117273757 missense probably benign 0.00
R5562:Taok3 UTSW 5 117250964 missense probably damaging 1.00
R5643:Taok3 UTSW 5 117206720 missense probably benign
R6241:Taok3 UTSW 5 117272197 missense probably benign 0.33
R6290:Taok3 UTSW 5 117204368 missense probably damaging 1.00
R6310:Taok3 UTSW 5 117255938 missense possibly damaging 0.48
R6339:Taok3 UTSW 5 117228030 missense probably benign
R6717:Taok3 UTSW 5 117240950 intron probably benign
R6721:Taok3 UTSW 5 117255863 missense probably benign 0.25
R6755:Taok3 UTSW 5 117206667 missense probably damaging 1.00
R7046:Taok3 UTSW 5 117273706 missense probably damaging 1.00
R7259:Taok3 UTSW 5 117252543 missense probably benign 0.00
R7308:Taok3 UTSW 5 117200151 nonsense probably null
R7439:Taok3 UTSW 5 117250909 missense probably damaging 0.99
R7732:Taok3 UTSW 5 117193748 missense possibly damaging 0.53
R7758:Taok3 UTSW 5 117250907 missense probably damaging 1.00
R7939:Taok3 UTSW 5 117193837 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCATGCATATATGTGATCCAC -3'
(R):5'- TTCAACAGCTGACCGCAGTG -3'

Sequencing Primer
(F):5'- ATGCATATATGTGATCCACCTTCAC -3'
(R):5'- TGACCGCAGTGCAGGTTG -3'
Posted On2019-05-13