Incidental Mutation 'R7053:Aldh1l1'
ID547707
Institutional Source Beutler Lab
Gene Symbol Aldh1l1
Ensembl Gene ENSMUSG00000030088
Gene Namealdehyde dehydrogenase 1 family, member L1
SynonymsFthfd, 1810048F20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location90486427-90600203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90563438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 235 (T235K)
Ref Sequence ENSEMBL: ENSMUSP00000145380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032175] [ENSMUST00000130418] [ENSMUST00000203111] [ENSMUST00000204796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032175
AA Change: T235K

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032175
Gene: ENSMUSG00000030088
AA Change: T235K

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 6.9e-53 PFAM
Pfam:Formyl_trans_C 204 310 4e-18 PFAM
Pfam:PP-binding 325 391 3.7e-6 PFAM
Pfam:Aldedh 430 898 1.3e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130418
AA Change: T235K

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114304
Gene: ENSMUSG00000030088
AA Change: T235K

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 7.4e-54 PFAM
Pfam:Formyl_trans_C 204 310 2.6e-18 PFAM
Pfam:Aldedh 430 898 1.7e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203111
SMART Domains Protein: ENSMUSP00000145233
Gene: ENSMUSG00000030088

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 4 135 4.2e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204796
AA Change: T235K

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145380
Gene: ENSMUSG00000030088
AA Change: T235K

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 3e-53 PFAM
Pfam:Formyl_trans_C 204 310 1.5e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Aldh1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Aldh1l1 APN 6 90598380 missense probably damaging 1.00
IGL01350:Aldh1l1 APN 6 90559356 missense probably damaging 1.00
IGL01601:Aldh1l1 APN 6 90591841 missense probably damaging 1.00
IGL01686:Aldh1l1 APN 6 90559233 splice site probably benign
IGL01868:Aldh1l1 APN 6 90583230 nonsense probably null
IGL01941:Aldh1l1 APN 6 90562695 missense probably damaging 0.98
IGL01982:Aldh1l1 APN 6 90559863 missense probably benign 0.00
IGL02088:Aldh1l1 APN 6 90580590 splice site probably benign
IGL02159:Aldh1l1 APN 6 90594656 splice site probably benign
IGL02450:Aldh1l1 APN 6 90569873 missense probably benign 0.00
IGL02657:Aldh1l1 APN 6 90590794 missense probably damaging 1.00
IGL02839:Aldh1l1 APN 6 90569875 missense possibly damaging 0.95
R0149:Aldh1l1 UTSW 6 90589414 missense possibly damaging 0.85
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0418:Aldh1l1 UTSW 6 90569893 missense possibly damaging 0.49
R1121:Aldh1l1 UTSW 6 90589384 missense probably benign
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1649:Aldh1l1 UTSW 6 90564389 missense probably benign
R1793:Aldh1l1 UTSW 6 90577831 missense possibly damaging 0.92
R2043:Aldh1l1 UTSW 6 90557332 missense probably benign 0.05
R2044:Aldh1l1 UTSW 6 90562665 missense probably benign 0.00
R2229:Aldh1l1 UTSW 6 90583186 missense probably damaging 1.00
R2426:Aldh1l1 UTSW 6 90598284 missense probably damaging 0.99
R4109:Aldh1l1 UTSW 6 90562644 missense probably benign 0.04
R4818:Aldh1l1 UTSW 6 90596915 missense probably benign
R5214:Aldh1l1 UTSW 6 90563417 missense probably damaging 1.00
R5285:Aldh1l1 UTSW 6 90576770 nonsense probably null
R5426:Aldh1l1 UTSW 6 90559299 missense probably benign
R5516:Aldh1l1 UTSW 6 90596945 missense possibly damaging 0.95
R5970:Aldh1l1 UTSW 6 90597046 intron probably benign
R6235:Aldh1l1 UTSW 6 90564457 missense probably benign 0.44
R6322:Aldh1l1 UTSW 6 90562698 missense probably benign 0.03
R7125:Aldh1l1 UTSW 6 90576779 critical splice donor site probably null
R7128:Aldh1l1 UTSW 6 90563379 missense probably benign 0.23
R7142:Aldh1l1 UTSW 6 90563416 missense probably damaging 1.00
R7203:Aldh1l1 UTSW 6 90570800 missense probably benign 0.01
R7205:Aldh1l1 UTSW 6 90598275 missense probably damaging 0.97
R7477:Aldh1l1 UTSW 6 90598387 critical splice donor site probably null
R7669:Aldh1l1 UTSW 6 90570862 missense probably benign
R7718:Aldh1l1 UTSW 6 90598323 missense probably damaging 1.00
R7788:Aldh1l1 UTSW 6 90569912 missense probably benign 0.20
RF007:Aldh1l1 UTSW 6 90598259 missense probably damaging 0.99
Z1176:Aldh1l1 UTSW 6 90557284 frame shift probably null
Z1176:Aldh1l1 UTSW 6 90583173 missense probably benign 0.11
Z1177:Aldh1l1 UTSW 6 90564449 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCTGCACTCAGACACATG -3'
(R):5'- AGCAGACATCTCACTTTTAGCTCTG -3'

Sequencing Primer
(F):5'- CACATGTCTAGGAGGAAGCCC -3'
(R):5'- GACATCTCACTTTTAGCTCTGAATGG -3'
Posted On2019-05-13