Incidental Mutation 'R7053:Adam26a'
ID547715
Institutional Source Beutler Lab
Gene Symbol Adam26a
Ensembl Gene ENSMUSG00000048516
Gene Namea disintegrin and metallopeptidase domain 26A (testase 3)
SynonymsDtgn4, Adam26
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location43568278-43576707 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 43568799 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 551 (C551*)
Ref Sequence ENSEMBL: ENSMUSP00000058256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049577]
Predicted Effect probably null
Transcript: ENSMUST00000049577
AA Change: C551*
SMART Domains Protein: ENSMUSP00000058256
Gene: ENSMUSG00000048516
AA Change: C551*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 2.1e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 2.2e-9 PFAM
Pfam:Reprolysin 195 385 2.7e-48 PFAM
Pfam:Reprolysin_2 215 377 2.4e-16 PFAM
Pfam:Reprolysin_3 219 340 1.2e-15 PFAM
DISIN 401 476 2.98e-41 SMART
ACR 477 613 2.06e-64 SMART
transmembrane domain 671 693 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during the late stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to two other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Adam26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Adam26a APN 8 43568859 missense possibly damaging 0.75
IGL00519:Adam26a APN 8 43569525 missense probably damaging 1.00
IGL00658:Adam26a APN 8 43568903 missense probably benign 0.00
IGL01514:Adam26a APN 8 43568448 missense probably benign
IGL01988:Adam26a APN 8 43569170 missense possibly damaging 0.68
IGL02030:Adam26a APN 8 43568857 missense probably benign 0.00
IGL02081:Adam26a APN 8 43570196 missense probably damaging 0.99
IGL02444:Adam26a APN 8 43569673 missense possibly damaging 0.46
IGL02734:Adam26a APN 8 43569775 missense probably benign 0.27
IGL03243:Adam26a APN 8 43568696 missense probably benign 0.14
IGL03350:Adam26a APN 8 43569552 nonsense probably null
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0324:Adam26a UTSW 8 43568453 missense probably benign
R0830:Adam26a UTSW 8 43568402 missense probably benign 0.23
R0960:Adam26a UTSW 8 43568763 missense probably damaging 1.00
R1259:Adam26a UTSW 8 43568647 missense probably benign 0.20
R1259:Adam26a UTSW 8 43568713 missense possibly damaging 0.95
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1719:Adam26a UTSW 8 43570036 missense possibly damaging 0.93
R1750:Adam26a UTSW 8 43570189 missense possibly damaging 0.90
R1860:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1861:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1875:Adam26a UTSW 8 43569851 missense probably benign 0.37
R3959:Adam26a UTSW 8 43569871 missense probably benign 0.00
R4355:Adam26a UTSW 8 43570185 missense probably benign 0.35
R4604:Adam26a UTSW 8 43570051 missense probably benign 0.02
R4612:Adam26a UTSW 8 43568793 missense probably damaging 0.99
R4909:Adam26a UTSW 8 43570438 missense probably benign 0.08
R4937:Adam26a UTSW 8 43568881 missense probably damaging 1.00
R5112:Adam26a UTSW 8 43568856 missense probably benign 0.04
R5276:Adam26a UTSW 8 43570420 missense probably benign 0.30
R5406:Adam26a UTSW 8 43569104 missense probably damaging 1.00
R5501:Adam26a UTSW 8 43569904 nonsense probably null
R5955:Adam26a UTSW 8 43569852 missense probably benign 0.11
R6262:Adam26a UTSW 8 43569088 missense possibly damaging 0.91
R6847:Adam26a UTSW 8 43568428 missense probably benign 0.23
R6957:Adam26a UTSW 8 43568903 missense probably benign 0.00
R7287:Adam26a UTSW 8 43570343 missense possibly damaging 0.95
R7393:Adam26a UTSW 8 43569688 missense probably benign 0.01
R7477:Adam26a UTSW 8 43569070 missense probably damaging 1.00
R7552:Adam26a UTSW 8 43569970 missense possibly damaging 0.77
R7670:Adam26a UTSW 8 43570153 missense probably benign 0.13
R7918:Adam26a UTSW 8 43569529 missense probably damaging 0.98
R8193:Adam26a UTSW 8 43569236 missense probably damaging 1.00
R8262:Adam26a UTSW 8 43569141 nonsense probably null
Z1088:Adam26a UTSW 8 43569698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACACACTTTCTGTCAACAC -3'
(R):5'- GAATCCCTTGCAGTGGTGAG -3'

Sequencing Primer
(F):5'- CTGTCAACACATATATGGTCTGGAGC -3'
(R):5'- GGGCTATTGCTATAAAATGGAATGTC -3'
Posted On2019-05-13